Incidental Mutation 'R7922:Vwa5a'
ID611307
Institutional Source Beutler Lab
Gene Symbol Vwa5a
Ensembl Gene ENSMUSG00000023186
Gene Namevon Willebrand factor A domain containing 5A
SynonymsLoh11cr2a, 5830475I06Rik, BCSC-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38718268-38743337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38723503 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 202 (S202R)
Ref Sequence ENSEMBL: ENSMUSP00000001544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144] [ENSMUST00000129598]
Predicted Effect probably damaging
Transcript: ENSMUST00000001544
AA Change: S202R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: S202R

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118144
AA Change: S202R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: S202R

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129598
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Vwa5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vwa5a APN 9 38737814 splice site probably null
IGL00966:Vwa5a APN 9 38723379 missense probably benign 0.24
IGL01597:Vwa5a APN 9 38733865 missense probably damaging 1.00
IGL01950:Vwa5a APN 9 38726970 missense probably damaging 1.00
IGL02008:Vwa5a APN 9 38737776 missense probably benign 0.08
IGL02326:Vwa5a APN 9 38737956 missense probably benign
IGL02378:Vwa5a APN 9 38733970 missense probably benign 0.41
IGL02442:Vwa5a APN 9 38734784 missense probably benign 0.02
IGL02458:Vwa5a APN 9 38726963 missense possibly damaging 0.79
IGL02570:Vwa5a APN 9 38734871 unclassified probably benign
IGL03068:Vwa5a APN 9 38734847 missense probably benign 0.45
R0126:Vwa5a UTSW 9 38737807 splice site probably null
R0325:Vwa5a UTSW 9 38728665 missense probably damaging 1.00
R0617:Vwa5a UTSW 9 38723895 missense probably damaging 1.00
R0928:Vwa5a UTSW 9 38728007 missense probably damaging 1.00
R1334:Vwa5a UTSW 9 38734741 missense probably benign 0.01
R1446:Vwa5a UTSW 9 38733968 missense possibly damaging 0.95
R1708:Vwa5a UTSW 9 38727832 missense probably benign
R1986:Vwa5a UTSW 9 38737814 splice site probably benign
R2024:Vwa5a UTSW 9 38736061 missense probably damaging 0.98
R2230:Vwa5a UTSW 9 38733878 missense probably null 1.00
R2252:Vwa5a UTSW 9 38728080 missense probably damaging 1.00
R2278:Vwa5a UTSW 9 38723207 missense probably damaging 1.00
R3912:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R3913:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R4172:Vwa5a UTSW 9 38723870 missense probably damaging 0.98
R4244:Vwa5a UTSW 9 38737816 splice site probably benign
R4510:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4511:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4549:Vwa5a UTSW 9 38737925 missense probably benign 0.09
R4591:Vwa5a UTSW 9 38735620 missense possibly damaging 0.94
R4639:Vwa5a UTSW 9 38727114 critical splice donor site probably null
R4811:Vwa5a UTSW 9 38735953 missense probably benign 0.00
R4911:Vwa5a UTSW 9 38737972 missense probably benign 0.03
R4936:Vwa5a UTSW 9 38736198 missense probably benign 0.00
R4989:Vwa5a UTSW 9 38722630 missense probably benign 0.40
R5370:Vwa5a UTSW 9 38741216 missense probably benign 0.02
R5596:Vwa5a UTSW 9 38722578 missense probably damaging 1.00
R5914:Vwa5a UTSW 9 38741742 missense probably benign 0.00
R6207:Vwa5a UTSW 9 38722672 missense probably damaging 1.00
R6486:Vwa5a UTSW 9 38733878 missense probably null 1.00
R7666:Vwa5a UTSW 9 38733963 missense probably benign 0.06
R7683:Vwa5a UTSW 9 38734829 missense probably damaging 1.00
R7763:Vwa5a UTSW 9 38741162 missense possibly damaging 0.93
R7839:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7996:Vwa5a UTSW 9 38727828 nonsense probably null
R8024:Vwa5a UTSW 9 38736020 nonsense probably null
X0022:Vwa5a UTSW 9 38735962 missense probably damaging 1.00
X0067:Vwa5a UTSW 9 38723251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTGACAGACTGGTGAGAAAATG -3'
(R):5'- TTGCCTATCCAAACATGGCC -3'

Sequencing Primer
(F):5'- CACAAAATTTTGGTTGTGCTGG -3'
(R):5'- GTTTGAGGAGACTGACAC -3'
Posted On2019-12-27