Incidental Mutation 'R7922:Degs2'
ID611318
Institutional Source Beutler Lab
Gene Symbol Degs2
Ensembl Gene ENSMUSG00000021263
Gene Namedelta(4)-desaturase, sphingolipid 2
SynonymsDes2, 2210008A03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score217.468
Status Not validated
Chromosome12
Chromosomal Location108678711-108702315 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTAGTGAAT to CT at 108692201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000021691] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000167978] [ENSMUST00000172409]
Predicted Effect probably benign
Transcript: ENSMUST00000021689
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021691
SMART Domains Protein: ENSMUSP00000021691
Gene: ENSMUSG00000021263

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 65 294 3.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077735
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109854
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167978
SMART Domains Protein: ENSMUSP00000125891
Gene: ENSMUSG00000021263

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 64 275 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172409
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222255
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Degs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Degs2 APN 12 108691995 missense probably damaging 1.00
IGL02755:Degs2 APN 12 108692583 missense probably benign
largo UTSW 12 108692154 missense probably damaging 1.00
R0039:Degs2 UTSW 12 108690589 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0441:Degs2 UTSW 12 108702214 missense probably damaging 0.97
R1642:Degs2 UTSW 12 108692192 missense probably benign
R4183:Degs2 UTSW 12 108692099 missense probably damaging 1.00
R4817:Degs2 UTSW 12 108689066 nonsense probably null
R6268:Degs2 UTSW 12 108692580 missense probably damaging 1.00
R6863:Degs2 UTSW 12 108702202 missense probably damaging 1.00
R7626:Degs2 UTSW 12 108692073 missense possibly damaging 0.68
R7839:Degs2 UTSW 12 108692201 frame shift probably null
Z1177:Degs2 UTSW 12 108692597 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCTCAGCCACAAAGTGACC -3'
(R):5'- AAGTTGTGTCTCCCGAAACC -3'

Sequencing Primer
(F):5'- TCAGCCACAAAGTGACCAGAGATAG -3'
(R):5'- AACCGCTGGTTTGCCATC -3'
Posted On2019-12-27