Incidental Mutation 'R7922:Glt8d1'
ID611319
Institutional Source Beutler Lab
Gene Symbol Glt8d1
Ensembl Gene ENSMUSG00000021916
Gene Nameglycosyltransferase 8 domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score115.008
Status Not validated
Chromosome14
Chromosomal Location31001400-31011991 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 31001831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000168584] [ENSMUST00000186131] [ENSMUST00000226374] [ENSMUST00000226378] [ENSMUST00000226782] [ENSMUST00000228736] [ENSMUST00000228767]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168584
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186131
SMART Domains Protein: ENSMUSP00000139654
Gene: ENSMUSG00000021917

DomainStartEndE-ValueType
Pfam:SPC12 71 149 2.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226374
Predicted Effect probably benign
Transcript: ENSMUST00000226378
Predicted Effect probably benign
Transcript: ENSMUST00000226782
Predicted Effect probably benign
Transcript: ENSMUST00000228736
Predicted Effect probably benign
Transcript: ENSMUST00000228767
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyltransferase family. The encoded protein is a type II transmembrane protein containing a glycosyltransferase 8 domain in the lumenal (C-terminal) portion. The specific function of this protein has not been determined. Two alternatively spliced variants encoding the same isoform have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display exhibited impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Glt8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Glt8d1 APN 14 31008810 missense probably damaging 1.00
IGL03087:Glt8d1 APN 14 31010096 missense probably damaging 1.00
R0494:Glt8d1 UTSW 14 31011623 missense possibly damaging 0.87
R0531:Glt8d1 UTSW 14 31006504 missense probably benign 0.00
R0594:Glt8d1 UTSW 14 31010410 critical splice donor site probably null
R1540:Glt8d1 UTSW 14 31011592 missense probably benign 0.00
R1715:Glt8d1 UTSW 14 31011521 missense possibly damaging 0.95
R2055:Glt8d1 UTSW 14 31009736 missense probably benign 0.00
R3081:Glt8d1 UTSW 14 31006660 missense probably benign
R4676:Glt8d1 UTSW 14 31006692 missense probably benign
R7143:Glt8d1 UTSW 14 31006645 missense probably damaging 0.97
R7733:Glt8d1 UTSW 14 31001978 unclassified probably benign
R7839:Glt8d1 UTSW 14 31001831 unclassified probably benign
R7871:Glt8d1 UTSW 14 31010339 missense probably damaging 0.98
R7954:Glt8d1 UTSW 14 31010339 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAGCGACGGCCTTTACTCG -3'
(R):5'- AGCCTCCTTACGCTTAGGAGTG -3'

Sequencing Primer
(F):5'- GCCTTTACTCGGGGAGGAC -3'
(R):5'- CTCCTTACGCTTAGGAGTGATGGG -3'
Posted On2019-12-27