Incidental Mutation 'R7922:Cyp2d22'
ID611323
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms2D22
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82370527-82380260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82372571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 334 (V334A)
Ref Sequence ENSEMBL: ENSMUSP00000023083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
Predicted Effect probably damaging
Transcript: ENSMUST00000023083
AA Change: V334A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: V334A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228986
AA Change: V96A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82371668 missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82374369 missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82372845 missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82373241 missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82371668 missense probably damaging 1.00
R0165:Cyp2d22 UTSW 15 82373280 missense probably benign 0.06
R0294:Cyp2d22 UTSW 15 82374445 missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82372508 missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82371936 missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82373978 missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82373172 missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82375827 missense probably benign 0.11
R4492:Cyp2d22 UTSW 15 82374370 missense probably benign 0.00
R4575:Cyp2d22 UTSW 15 82371932 missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R5344:Cyp2d22 UTSW 15 82371638 missense possibly damaging 0.95
R5523:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82373813 missense probably benign
R6060:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82371905 missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82373835 critical splice acceptor site probably null
R6279:Cyp2d22 UTSW 15 82373968 missense probably damaging 1.00
R6563:Cyp2d22 UTSW 15 82371912 missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82375852 missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82374411 missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCTAGCTGGCAACACC -3'
(R):5'- AGGCACAGTCCTTAAACTTACTTAG -3'

Sequencing Primer
(F):5'- ACTAGACATTGGAGGGTCCC -3'
(R):5'- ACTTAGGACATTTGTGGCTCCCAG -3'
Posted On2019-12-27