Incidental Mutation 'R7922:Nell2'
ID611324
Institutional Source Beutler Lab
Gene Symbol Nell2
Ensembl Gene ENSMUSG00000022454
Gene NameNEL-like 2
SynonymsA330108N19Rik, mel91
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location95075230-95528559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95298938 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 499 (N499S)
Ref Sequence ENSEMBL: ENSMUSP00000074751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]
Predicted Effect probably benign
Transcript: ENSMUST00000075275
AA Change: N499S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: N499S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166170
AA Change: N499S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: N499S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229933
AA Change: N499S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000229981
AA Change: N499S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Nell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Nell2 APN 15 95527285 missense possibly damaging 0.94
IGL00919:Nell2 APN 15 95383727 missense possibly damaging 0.88
IGL01124:Nell2 APN 15 95296179 missense probably damaging 1.00
IGL01356:Nell2 APN 15 95229183 missense probably damaging 0.99
IGL01865:Nell2 APN 15 95385081 missense possibly damaging 0.74
IGL02324:Nell2 APN 15 95229101 missense probably damaging 0.99
IGL02505:Nell2 APN 15 95296263 splice site probably benign
PIT4495001:Nell2 UTSW 15 95383727 missense probably benign 0.33
R0112:Nell2 UTSW 15 95431681 splice site probably benign
R0139:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0355:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0481:Nell2 UTSW 15 95432682 splice site probably null
R0535:Nell2 UTSW 15 95431607 missense probably benign 0.10
R0607:Nell2 UTSW 15 95229214 missense probably benign 0.06
R1378:Nell2 UTSW 15 95232521 missense probably damaging 1.00
R1688:Nell2 UTSW 15 95431613 missense probably damaging 0.97
R2054:Nell2 UTSW 15 95435109 missense probably benign 0.00
R2163:Nell2 UTSW 15 95429978 missense probably damaging 1.00
R2176:Nell2 UTSW 15 95435157 missense probably damaging 0.97
R3745:Nell2 UTSW 15 95432673 missense probably damaging 1.00
R5055:Nell2 UTSW 15 95473579 missense probably benign 0.00
R5184:Nell2 UTSW 15 95527809 missense possibly damaging 0.78
R5382:Nell2 UTSW 15 95229210 missense probably damaging 1.00
R6145:Nell2 UTSW 15 95473561 missense probably damaging 1.00
R6264:Nell2 UTSW 15 95346825 missense probably damaging 0.99
R6337:Nell2 UTSW 15 95385144 missense probably damaging 1.00
R6423:Nell2 UTSW 15 95527282 missense probably damaging 1.00
R6438:Nell2 UTSW 15 95232498 missense probably damaging 1.00
R6579:Nell2 UTSW 15 95385076 missense possibly damaging 0.88
R6810:Nell2 UTSW 15 95241587 missense probably damaging 1.00
R6894:Nell2 UTSW 15 95346887 missense probably damaging 1.00
R7016:Nell2 UTSW 15 95229151 missense possibly damaging 0.87
R7266:Nell2 UTSW 15 95435393 missense possibly damaging 0.50
R7761:Nell2 UTSW 15 95432669 missense probably damaging 1.00
R7839:Nell2 UTSW 15 95298938 missense probably benign 0.01
R8000:Nell2 UTSW 15 95435274 missense probably damaging 1.00
X0038:Nell2 UTSW 15 95527812 missense probably benign
Z1088:Nell2 UTSW 15 95435097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCTGTCCATGAGGTG -3'
(R):5'- GCAGGCCTTTGCTTCAATTAC -3'

Sequencing Primer
(F):5'- CTGTCCATGAGGTGCAGAG -3'
(R):5'- AGGCCTTTGCTTCAATTACTTTTGG -3'
Posted On2019-12-27