Incidental Mutation 'R7922:Mettl7a1'
ID611325
Institutional Source Beutler Lab
Gene Symbol Mettl7a1
Ensembl Gene ENSMUSG00000054619
Gene Namemethyltransferase like 7A1
SynonymsMettl7a, 3300001H21Rik, 2210414H16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100304140-100328662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100305076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 77 (V77A)
Ref Sequence ENSEMBL: ENSMUSP00000065271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067752] [ENSMUST00000229217] [ENSMUST00000229574] [ENSMUST00000229588] [ENSMUST00000230018] [ENSMUST00000230252] [ENSMUST00000230472] [ENSMUST00000231166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067752
AA Change: V77A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065271
Gene: ENSMUSG00000054619
AA Change: V77A

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 31 195 7.7e-12 PFAM
Pfam:Methyltransf_23 47 221 7e-20 PFAM
Pfam:Methyltransf_31 68 223 1.5e-15 PFAM
Pfam:Methyltransf_18 71 176 1e-9 PFAM
Pfam:Methyltransf_25 74 168 4e-12 PFAM
Pfam:Methyltransf_12 75 170 8.6e-16 PFAM
Pfam:Methyltransf_11 75 172 6.6e-23 PFAM
Pfam:Methyltransf_8 117 197 1.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229217
Predicted Effect probably null
Transcript: ENSMUST00000229574
Predicted Effect probably damaging
Transcript: ENSMUST00000229588
AA Change: V77A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230018
Predicted Effect probably null
Transcript: ENSMUST00000230252
Predicted Effect possibly damaging
Transcript: ENSMUST00000230472
AA Change: V59A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect silent
Transcript: ENSMUST00000231166
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Mettl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02820:Mettl7a1 APN 15 100305052 nonsense probably null
R0943:Mettl7a1 UTSW 15 100304958 missense probably benign 0.19
R2258:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R2259:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R4260:Mettl7a1 UTSW 15 100313070 missense probably benign 0.12
R4625:Mettl7a1 UTSW 15 100313058 missense probably damaging 1.00
R4932:Mettl7a1 UTSW 15 100305106 missense probably benign 0.26
R7802:Mettl7a1 UTSW 15 100305301 missense possibly damaging 0.80
R7839:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CTGCTGAACCTTCTAGGCTTG -3'
(R):5'- ACGCAGAATCTTCTCCTGGTTC -3'

Sequencing Primer
(F):5'- CTGAACCTTCTAGGCTTGTGGAG -3'
(R):5'- GTTCTTCACCGAGCACAGC -3'
Posted On2019-12-27