Incidental Mutation 'R7922:Adcyap1'
ID611328
Institutional Source Beutler Lab
Gene Symbol Adcyap1
Ensembl Gene ENSMUSG00000024256
Gene Nameadenylate cyclase activating polypeptide 1
SynonymsPACAP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location93199422-93205485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93203985 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 129 (K129R)
Ref Sequence ENSEMBL: ENSMUSP00000067057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064775]
Predicted Effect probably benign
Transcript: ENSMUST00000064775
AA Change: K129R

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000067057
Gene: ENSMUSG00000024256
AA Change: K129R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLUCA 82 108 3.4e-4 SMART
GLUCA 131 157 3.99e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glucagon superfamily of hormones that have important roles in growth and metabolism. The encoded protein undergoes proteolytic processing to generate mature peptides that function as hypophysiotropic hormones, neurotransmitters, neuromodulators and vasoregulators. Mice lacking the encoded protein exhibit a high rate of early mortality. The surviving adult animals lacking the encoded protein exhibit decreased anxiety, hyperactive behavior and impaired steroidogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high postnatal mortality, impaired thermoregulation, and loss of white fat. Survivors show ketosis, microvesicular fat accumulation, elevated serum lipids, and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Adcyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Adcyap1 APN 17 93203964 missense probably benign 0.05
IGL01551:Adcyap1 APN 17 93204018 missense probably damaging 1.00
IGL01665:Adcyap1 APN 17 93200078 missense probably damaging 1.00
R0325:Adcyap1 UTSW 17 93202832 missense probably benign 0.00
R1459:Adcyap1 UTSW 17 93200122 critical splice donor site probably null
R2191:Adcyap1 UTSW 17 93200026 missense possibly damaging 0.88
R2348:Adcyap1 UTSW 17 93202274 missense possibly damaging 0.92
R4334:Adcyap1 UTSW 17 93202268 missense probably benign 0.10
R4935:Adcyap1 UTSW 17 93204113 missense probably benign 0.01
R6329:Adcyap1 UTSW 17 93202799 missense probably benign
R6337:Adcyap1 UTSW 17 93202281 nonsense probably null
R7414:Adcyap1 UTSW 17 93202828 missense probably damaging 1.00
R7527:Adcyap1 UTSW 17 93202829 nonsense probably null
R7839:Adcyap1 UTSW 17 93203985 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTCAGTCACAGTATTCCCGC -3'
(R):5'- TTTATACACAAGGTAGCCGGCAG -3'

Sequencing Primer
(F):5'- TCACAGTATTCCCGCCAGCG -3'
(R):5'- CAGCTGATCTGCTACAAGTATGC -3'
Posted On2019-12-27