Incidental Mutation 'R7922:Aqp4'
ID611329
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Nameaquaporin 4
Synonymsaquaporin-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location15389394-15403684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15399680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 119 (I119F)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079081
AA Change: I119F

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: I119F

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Z1177:Aqp4 UTSW 18 15399881 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTGGCCACCTTTCACCAG -3'
(R):5'- CAGCAGAATTTCTGGCCACG -3'

Sequencing Primer
(F):5'- TTCACCAGAGTTTGCAAGCACATG -3'
(R):5'- CCATAAACTGGGGTGGCTCAG -3'
Posted On2019-12-27