Incidental Mutation 'R7922:Glis3'
ID611330
Institutional Source Beutler Lab
Gene Symbol Glis3
Ensembl Gene ENSMUSG00000052942
Gene NameGLIS family zinc finger 3
SynonymsE330013K21Rik, 4833409N03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location28258851-28680077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28317373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 675 (D675G)
Ref Sequence ENSEMBL: ENSMUSP00000124635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065113] [ENSMUST00000162022]
Predicted Effect probably benign
Transcript: ENSMUST00000065113
SMART Domains Protein: ENSMUSP00000066953
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162022
AA Change: D675G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124635
Gene: ENSMUSG00000052942
AA Change: D675G

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
low complexity region 700 709 N/A INTRINSIC
low complexity region 722 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein which contains multiple C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the transcriptional regulation of insulin. It is thought to enhance GLI-RE-dependent transcription by binding to the GLI-RE consensus sequence (GACCACCCAC). Mutations in a similar gene in human have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit postnatal lethality associated with neonatal diabetes and polycystic kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Glis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Glis3 APN 19 28540264 missense probably damaging 1.00
IGL02240:Glis3 APN 19 28531525 missense probably damaging 1.00
IGL02347:Glis3 APN 19 28531883 missense probably benign
IGL02904:Glis3 APN 19 28357952 missense possibly damaging 0.58
glee UTSW 19 28262677 utr 3 prime probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0399:Glis3 UTSW 19 28298768 splice site probably benign
R1462:Glis3 UTSW 19 28262518 utr 3 prime probably benign
R1901:Glis3 UTSW 19 28531585 missense probably damaging 1.00
R1976:Glis3 UTSW 19 28262677 utr 3 prime probably benign
R1982:Glis3 UTSW 19 28531274 missense probably damaging 1.00
R2155:Glis3 UTSW 19 28531302 missense probably benign 0.16
R3723:Glis3 UTSW 19 28262591 nonsense probably null
R4496:Glis3 UTSW 19 28666127 missense possibly damaging 0.90
R4921:Glis3 UTSW 19 28666104 missense probably damaging 1.00
R5088:Glis3 UTSW 19 28531579 missense probably benign 0.00
R5241:Glis3 UTSW 19 28350023 missense probably benign 0.02
R5557:Glis3 UTSW 19 28264009 missense probably benign 0.00
R6226:Glis3 UTSW 19 28317302 missense probably damaging 1.00
R6309:Glis3 UTSW 19 28317361 missense probably benign 0.24
R6488:Glis3 UTSW 19 28298853 missense probably benign 0.13
R7069:Glis3 UTSW 19 28531519 missense probably damaging 1.00
R7260:Glis3 UTSW 19 28531402 missense probably benign
R7313:Glis3 UTSW 19 28531019 missense probably damaging 1.00
R7320:Glis3 UTSW 19 28531598 missense probably damaging 1.00
R7767:Glis3 UTSW 19 28263960 missense probably benign 0.18
R7839:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
T0970:Glis3 UTSW 19 28530932 missense probably damaging 1.00
Z1176:Glis3 UTSW 19 28283768 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGACACCGCAGATGAGTCTC -3'
(R):5'- GTCTCCTAAAGTACCCACCAGG -3'

Sequencing Primer
(F):5'- TCTCAGGCGAACAAGATTTGCTG -3'
(R):5'- GGCCAGATAACTGACCCTTCTG -3'
Posted On2019-12-27