Incidental Mutation 'R7923:Ccdc180'
ID611342
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45900461 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 275 (Y275F)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: Y267F

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178561
AA Change: Y275F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: Y275F

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fpr1 A T 17: 17,877,372 F118L probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gabra4 A C 5: 71,640,913 probably null Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Nup210l A T 3: 90,122,729 I250L probably benign Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Setbp1 G A 18: 78,783,424 P1325S probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Traf3ip2 C G 10: 39,626,455 Q200E probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Upp2 G T 2: 58,774,115 probably null Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
R7925:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAATGAGCTCCTTGGTGG -3'
(R):5'- CATGCAGCTATAGACAGCAGG -3'

Sequencing Primer
(F):5'- CAAATGAGCTCCTTGGTGGCTTTG -3'
(R):5'- GCAGTCCACAATGATTGCTACCG -3'
Posted On2019-12-27