Incidental Mutation 'R0685:Trpv3'
ID 61135
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Name transient receptor potential cation channel, subfamily V, member 3
Synonyms VRL3, 1110036I10Rik, Nh
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0685 (G1)
Quality Score 210
Status Validated
Chromosome 11
Chromosomal Location 73158315-73191194 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 73187640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
AlphaFold Q8K424
PDB Structure Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049676
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,469,337 (GRCm39) D17G probably damaging Het
Abi3bp A G 16: 56,353,316 (GRCm39) T82A possibly damaging Het
Adgre4 A C 17: 56,099,035 (GRCm39) E180D probably benign Het
Ankrd28 G A 14: 31,465,407 (GRCm39) probably benign Het
Aoc3 A G 11: 101,227,273 (GRCm39) D382G possibly damaging Het
Apob C A 12: 8,060,742 (GRCm39) R3075S probably benign Het
Aqr A G 2: 113,971,458 (GRCm39) F459S probably damaging Het
Bcr T C 10: 74,967,475 (GRCm39) W570R probably damaging Het
Bloc1s5 C T 13: 38,787,895 (GRCm39) R163K probably benign Het
Bod1 A T 11: 31,619,267 (GRCm39) N101K possibly damaging Het
Bysl A T 17: 47,913,396 (GRCm39) S296T probably benign Het
Chl1 G A 6: 103,685,503 (GRCm39) probably null Het
Clstn1 G A 4: 149,731,312 (GRCm39) A885T probably benign Het
Cyp3a25 G T 5: 145,935,356 (GRCm39) P87T probably damaging Het
Dync1h1 T C 12: 110,623,626 (GRCm39) V3633A probably damaging Het
Dynlt5 T C 4: 102,859,735 (GRCm39) Y96H probably damaging Het
Elp4 C A 2: 105,622,622 (GRCm39) C241F possibly damaging Het
Fat4 T A 3: 39,055,327 (GRCm39) F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 (GRCm39) H381Y possibly damaging Het
Gm10577 G T 4: 100,877,515 (GRCm39) probably benign Het
Gm9955 G T 18: 24,842,314 (GRCm39) probably benign Het
Gstm5 T A 3: 107,804,635 (GRCm39) I73N probably damaging Het
Gypa T A 8: 81,223,331 (GRCm39) probably benign Het
Hectd2 T A 19: 36,546,831 (GRCm39) V64D probably damaging Het
Igkv10-95 T A 6: 68,657,543 (GRCm39) Y20N probably benign Het
Il15 T C 8: 83,064,188 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kiz C A 2: 146,697,978 (GRCm39) probably benign Het
Lcmt2 C A 2: 120,969,721 (GRCm39) S234I probably benign Het
Lilra5 A G 7: 4,244,956 (GRCm39) probably benign Het
Lin37 T C 7: 30,255,299 (GRCm39) E187G probably damaging Het
Lrrc37 T C 11: 103,507,714 (GRCm39) probably benign Het
Mcmdc2 T A 1: 9,982,039 (GRCm39) probably null Het
Mctp1 T C 13: 76,973,918 (GRCm39) probably null Het
Mdp1 C A 14: 55,896,726 (GRCm39) G112* probably null Het
Mmp15 T C 8: 96,098,762 (GRCm39) Y530H possibly damaging Het
Mtss2 T C 8: 111,454,029 (GRCm39) probably null Het
Muc5ac T C 7: 141,361,446 (GRCm39) S1586P probably benign Het
Nap1l5 A T 6: 58,883,757 (GRCm39) C66S possibly damaging Het
Ninl G T 2: 150,781,775 (GRCm39) Q1237K possibly damaging Het
Or5p70 A T 7: 107,994,470 (GRCm39) T48S possibly damaging Het
Or9m1b T C 2: 87,836,762 (GRCm39) E111G probably damaging Het
Orc6 T G 8: 86,027,783 (GRCm39) S37R possibly damaging Het
Papss1 A C 3: 131,288,854 (GRCm39) N119H possibly damaging Het
Phf13 A T 4: 152,076,069 (GRCm39) F278I probably damaging Het
Pole2 C A 12: 69,258,187 (GRCm39) A239S probably damaging Het
Ppt2 T C 17: 34,845,546 (GRCm39) D75G probably damaging Het
Psd2 A G 18: 36,136,044 (GRCm39) D443G possibly damaging Het
Psen1 C A 12: 83,761,594 (GRCm39) S132* probably null Het
Psme4 A G 11: 30,828,415 (GRCm39) T1812A probably damaging Het
Rasgrf1 T C 9: 89,797,535 (GRCm39) probably benign Het
Reep3 A G 10: 66,857,518 (GRCm39) probably benign Het
Rexo4 A T 2: 26,848,586 (GRCm39) probably benign Het
Rnf6 A C 5: 146,148,468 (GRCm39) S183R probably damaging Het
Scai A T 2: 38,993,749 (GRCm39) M297K probably damaging Het
Scn9a A T 2: 66,313,843 (GRCm39) S1947R probably benign Het
Sema6c T C 3: 95,080,021 (GRCm39) C772R possibly damaging Het
Skint7 T C 4: 111,837,542 (GRCm39) S107P possibly damaging Het
Slc24a3 A G 2: 145,448,715 (GRCm39) N420D probably benign Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Smg7 G A 1: 152,742,399 (GRCm39) P82L probably damaging Het
Sp3 A C 2: 72,801,342 (GRCm39) F268V probably damaging Het
Srms T C 2: 180,854,426 (GRCm39) D47G probably benign Het
Ss18 A C 18: 14,784,238 (GRCm39) M150R probably damaging Het
Taf5 G A 19: 47,063,293 (GRCm39) R281Q probably benign Het
Tars1 T C 15: 11,385,259 (GRCm39) K644R probably benign Het
Tinag C A 9: 76,859,285 (GRCm39) W441L probably damaging Het
Tmtc1 T C 6: 148,312,738 (GRCm39) S244G probably benign Het
Tpr T C 1: 150,309,476 (GRCm39) V1670A possibly damaging Het
Uhrf1 G T 17: 56,617,742 (GRCm39) V155L probably damaging Het
Ush2a G A 1: 188,132,475 (GRCm39) C899Y probably damaging Het
Vmn2r115 G A 17: 23,578,249 (GRCm39) R574H probably benign Het
Vmn2r63 T C 7: 42,577,434 (GRCm39) D368G probably benign Het
Vps13a A G 19: 16,758,105 (GRCm39) V10A probably damaging Het
Wbp11 A G 6: 136,791,636 (GRCm39) probably benign Het
Zcwpw1 A G 5: 137,797,854 (GRCm39) D145G probably benign Het
Zfp607a G A 7: 27,577,901 (GRCm39) V324I probably damaging Het
Zfp618 A G 4: 63,052,011 (GRCm39) I931V probably benign Het
Zfp821 T C 8: 110,451,174 (GRCm39) V389A possibly damaging Het
Zfp976 T A 7: 42,263,141 (GRCm39) H232L probably damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73,184,826 (GRCm39) critical splice donor site probably null
IGL01161:Trpv3 APN 11 73,187,544 (GRCm39) splice site probably benign
IGL02130:Trpv3 APN 11 73,170,596 (GRCm39) missense probably benign 0.00
IGL02957:Trpv3 APN 11 73,176,698 (GRCm39) missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73,172,491 (GRCm39) splice site probably benign
R0103:Trpv3 UTSW 11 73,184,805 (GRCm39) missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73,184,805 (GRCm39) missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73,188,013 (GRCm39) missense probably damaging 1.00
R0969:Trpv3 UTSW 11 73,169,764 (GRCm39) nonsense probably null
R1748:Trpv3 UTSW 11 73,186,209 (GRCm39) missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73,174,514 (GRCm39) missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73,170,653 (GRCm39) missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73,186,281 (GRCm39) missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73,169,780 (GRCm39) missense probably benign
R3916:Trpv3 UTSW 11 73,174,560 (GRCm39) missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73,174,560 (GRCm39) missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73,178,246 (GRCm39) nonsense probably null
R4242:Trpv3 UTSW 11 73,168,649 (GRCm39) missense probably benign 0.43
R4277:Trpv3 UTSW 11 73,187,264 (GRCm39) missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73,186,150 (GRCm39) missense probably benign 0.40
R4629:Trpv3 UTSW 11 73,172,615 (GRCm39) missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73,186,240 (GRCm39) missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73,186,149 (GRCm39) missense probably benign 0.00
R5121:Trpv3 UTSW 11 73,168,660 (GRCm39) critical splice donor site probably null
R6113:Trpv3 UTSW 11 73,176,844 (GRCm39) missense probably benign 0.10
R6130:Trpv3 UTSW 11 73,187,309 (GRCm39) missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73,174,689 (GRCm39) missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73,182,519 (GRCm39) missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73,168,818 (GRCm39) missense probably benign
R7434:Trpv3 UTSW 11 73,179,087 (GRCm39) missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73,168,800 (GRCm39) missense probably benign 0.37
R7741:Trpv3 UTSW 11 73,179,088 (GRCm39) missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73,176,847 (GRCm39) missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73,168,558 (GRCm39) missense probably benign 0.43
R8309:Trpv3 UTSW 11 73,170,747 (GRCm39) missense probably damaging 1.00
R8354:Trpv3 UTSW 11 73,182,448 (GRCm39) missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73,180,127 (GRCm39) missense probably benign 0.30
R8443:Trpv3 UTSW 11 73,186,209 (GRCm39) missense possibly damaging 0.84
R8454:Trpv3 UTSW 11 73,182,448 (GRCm39) missense probably damaging 1.00
R8492:Trpv3 UTSW 11 73,179,035 (GRCm39) nonsense probably null
R8556:Trpv3 UTSW 11 73,178,291 (GRCm39) missense probably benign
R8701:Trpv3 UTSW 11 73,169,762 (GRCm39) missense possibly damaging 0.84
R9046:Trpv3 UTSW 11 73,176,698 (GRCm39) missense probably damaging 1.00
R9431:Trpv3 UTSW 11 73,178,225 (GRCm39) missense probably benign
R9492:Trpv3 UTSW 11 73,187,267 (GRCm39) missense probably damaging 0.99
R9748:Trpv3 UTSW 11 73,174,499 (GRCm39) missense possibly damaging 0.84
Z1186:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1186:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1186:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGACGTGGGTAGGATCAGCAAAC -3'
(R):5'- TGGTACTGAGGCTAGAACCAAGGAC -3'

Sequencing Primer
(F):5'- GAGGTTGGAGCATCCCTG -3'
(R):5'- GGCTAGAACCAAGGACCTAAGC -3'
Posted On 2013-07-30