Incidental Mutation 'R7923:Traf3ip2'
ID611366
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene NameTRAF3 interacting protein 2
SynonymsAct1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location39612934-39655307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 39626455 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 200 (Q200E)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
Predicted Effect probably damaging
Transcript: ENSMUST00000019987
AA Change: Q200E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: Q200E

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 Y275F possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fpr1 A T 17: 17,877,372 F118L probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gabra4 A C 5: 71,640,913 probably null Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Nup210l A T 3: 90,122,729 I250L probably benign Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Setbp1 G A 18: 78,783,424 P1325S probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Upp2 G T 2: 58,774,115 probably null Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39634660 missense probably benign
IGL02097:Traf3ip2 APN 10 39654479 missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39646906 missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39654410 missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39626219 missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39639222 missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39645708 missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39634673 missense probably damaging 0.96
R1282:Traf3ip2 UTSW 10 39626405 missense probably damaging 1.00
R1913:Traf3ip2 UTSW 10 39625940 missense probably benign 0.00
R2975:Traf3ip2 UTSW 10 39626540 missense probably benign 0.00
R4575:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4576:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4681:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39645739 missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39626100 missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39626477 missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39641341 missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39639404 splice site probably null
R6462:Traf3ip2 UTSW 10 39639247 missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39626177 missense possibly damaging 0.61
R7840:Traf3ip2 UTSW 10 39626455 missense probably damaging 0.99
X0020:Traf3ip2 UTSW 10 39654519 missense probably damaging 0.97
Z1177:Traf3ip2 UTSW 10 39626533 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCAATAGATGGCTGGGATC -3'
(R):5'- GTAGTACTGACAGTTCCATGGG -3'

Sequencing Primer
(F):5'- TGACACTGGCCATGAATCAG -3'
(R):5'- TGACAGTTCCATGGGGCCTG -3'
Posted On2019-12-27