Incidental Mutation 'R7923:Fpr1'
ID611394
Institutional Source Beutler Lab
Gene Symbol Fpr1
Ensembl Gene ENSMUSG00000045551
Gene Nameformyl peptide receptor 1
SynonymsfMLF-R, FPR
Accession Numbers

Genbank: NM_013521

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location17876471-17883940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17877372 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 118 (F118L)
Ref Sequence ENSEMBL: ENSMUSP00000052894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061516]
Predicted Effect probably benign
Transcript: ENSMUST00000061516
AA Change: F118L

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052894
Gene: ENSMUSG00000045551
AA Change: F118L

DomainStartEndE-ValueType
Pfam:7tm_1 51 312 8.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted null mice are viable and developmentally normal but show increased susceptibility to L. monocytogenes challenge, as shown by increased mortality and bacterial burden in liver/spleen early post-infection. Mutant neutrophils fail to respond to fMLF either in calcium flux or chemotaxis assays. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 Y275F possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gabra4 A C 5: 71,640,913 probably null Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Nup210l A T 3: 90,122,729 I250L probably benign Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Setbp1 G A 18: 78,783,424 P1325S probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Traf3ip2 C G 10: 39,626,455 Q200E probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Upp2 G T 2: 58,774,115 probably null Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Fpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Fpr1 APN 17 17877001 missense probably benign 0.00
IGL01473:Fpr1 APN 17 17877692 missense possibly damaging 0.95
IGL01704:Fpr1 APN 17 17876972 missense possibly damaging 0.64
IGL01900:Fpr1 APN 17 17877521 missense probably damaging 0.96
IGL02548:Fpr1 APN 17 17876653 missense probably benign 0.01
G5030:Fpr1 UTSW 17 17876806 missense probably damaging 1.00
PIT4445001:Fpr1 UTSW 17 17876893 missense probably benign
R0284:Fpr1 UTSW 17 17877356 missense probably damaging 0.99
R1440:Fpr1 UTSW 17 17877263 missense probably benign 0.01
R1631:Fpr1 UTSW 17 17877001 missense probably benign 0.00
R1823:Fpr1 UTSW 17 17877053 missense probably benign 0.00
R1994:Fpr1 UTSW 17 17877617 missense probably benign 0.01
R2168:Fpr1 UTSW 17 17877209 missense possibly damaging 0.52
R2364:Fpr1 UTSW 17 17877610 nonsense probably null
R3110:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3111:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3112:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3440:Fpr1 UTSW 17 17877158 missense probably benign
R3949:Fpr1 UTSW 17 17876929 missense probably benign
R5745:Fpr1 UTSW 17 17877082 missense probably benign 0.05
R5750:Fpr1 UTSW 17 17877263 missense probably benign 0.01
R6130:Fpr1 UTSW 17 17877635 missense probably benign 0.13
R6187:Fpr1 UTSW 17 17876928 nonsense probably null
R7017:Fpr1 UTSW 17 17877392 missense probably benign 0.00
R7358:Fpr1 UTSW 17 17876980 missense probably damaging 0.99
R7840:Fpr1 UTSW 17 17877372 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGACTGTGGTCAAACGAATGATAAC -3'
(R):5'- GCCGTCACATTTGTCCTTGG -3'

Sequencing Primer
(F):5'- TCAAACGAATGATAACTGGCAATG -3'
(R):5'- CCTTGGGGTTCTGGGCAAC -3'
Posted On2019-12-27