Mutagenetix > Incidental Mutation

Incidental Mutation 'R0685:Smc1b'

61144

Institutional Source

Beutler Lab

Gene Symbol

Smc1b

Ensembl Gene

ENSMUSG00000022432

Gene Name

structural maintenance of chromosomes 1B

Synonyms

SMC1beta, Smc1l2

MMRRC Submission

038870-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.691) question?

Stock #

R0685 (G1)

Quality Score

129

Status

Validated

Chromosome

Chromosomal Location

85064689-85131964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85070820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1077 (D1077G)

Ref Sequence

ENSEMBL: ENSMUSP00000023068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]

AlphaFold

Q920F6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023068
AA Change: D1077G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: D1077G

Domain	Start	End	E-Value	Type
Pfam:AAA_23	7	361	2e-10	PFAM
Pfam:AAA_21	27	372	7.2e-9	PFAM
low complexity region	422	437	N/A	INTRINSIC
SMC_hinge	513	629	1.5e-23	SMART
PDB:1W1W\|D	1046	1218	3e-42	PDB
Blast:AAA	1063	1217	5e-25	BLAST
SCOP:d1e69a_	1114	1202	3e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227591

Meta Mutation Damage Score

0.3847

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Chl1	G	A	6: 103,708,542		probably null	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gstm5	T	A	3: 107,897,319	I73N	probably damaging	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Il15	T	C	8: 82,337,559		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tinag	C	A	9: 76,952,003	W441L	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Uhrf1	G	T	17: 56,310,742	V155L	probably damaging	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Smc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Smc1b	APN	15	85129700	missense	possibly damaging	0.95
IGL01293:Smc1b	APN	15	85131898	missense	probably damaging	1.00
IGL01656:Smc1b	APN	15	85114776	missense	probably damaging	0.99
IGL01807:Smc1b	APN	15	85096745	missense	probably damaging	0.97
IGL02094:Smc1b	APN	15	85097891	splice site	probably benign
IGL02121:Smc1b	APN	15	85097985	missense	probably benign
IGL02631:Smc1b	APN	15	85107003	missense	probably damaging	0.98
IGL02678:Smc1b	APN	15	85065000	nonsense	probably null
IGL03197:Smc1b	APN	15	85070863	missense	possibly damaging	0.85
IGL03214:Smc1b	APN	15	85097946	nonsense	probably null
IGL03218:Smc1b	APN	15	85089713	missense	probably benign	0.07
IGL03232:Smc1b	APN	15	85129720	missense	possibly damaging	0.68
adamantine	UTSW	15	85121641	missense	probably benign	0.06
unbreakable	UTSW	15	85096658	missense	probably benign
E0370:Smc1b	UTSW	15	85127581	missense	probably damaging	1.00
PIT4812001:Smc1b	UTSW	15	85069651	missense	possibly damaging	0.91
R0092:Smc1b	UTSW	15	85067724	unclassified	probably benign
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0207:Smc1b	UTSW	15	85123759	missense	probably benign
R0390:Smc1b	UTSW	15	85066277	missense	probably damaging	1.00
R0440:Smc1b	UTSW	15	85112673	splice site	probably benign
R1109:Smc1b	UTSW	15	85112815	missense	probably damaging	0.98
R1392:Smc1b	UTSW	15	85107070	splice site	probably benign
R1509:Smc1b	UTSW	15	85086134	missense	probably benign
R1804:Smc1b	UTSW	15	85127790	missense	possibly damaging	0.90
R1879:Smc1b	UTSW	15	85092067	missense	probably benign	0.01
R2086:Smc1b	UTSW	15	85121851	splice site	probably benign
R2143:Smc1b	UTSW	15	85123802	missense	probably benign
R2158:Smc1b	UTSW	15	85121851	splice site	probably benign
R2174:Smc1b	UTSW	15	85121851	splice site	probably benign
R2471:Smc1b	UTSW	15	85092017	missense	probably damaging	0.98
R3689:Smc1b	UTSW	15	85117263	intron	probably benign
R3690:Smc1b	UTSW	15	85117263	intron	probably benign
R4178:Smc1b	UTSW	15	85120647	missense	possibly damaging	0.94
R4420:Smc1b	UTSW	15	85112830	missense	probably damaging	1.00
R4905:Smc1b	UTSW	15	85066227	missense	probably damaging	1.00
R4919:Smc1b	UTSW	15	85117104	intron	probably benign
R5114:Smc1b	UTSW	15	85064984	missense	probably damaging	1.00
R5314:Smc1b	UTSW	15	85070865	missense	probably benign	0.00
R5476:Smc1b	UTSW	15	85086151	missense	probably damaging	0.97
R5593:Smc1b	UTSW	15	85121641	missense	probably benign	0.06
R5690:Smc1b	UTSW	15	85112773	missense	probably damaging	1.00
R5719:Smc1b	UTSW	15	85096658	missense	probably benign
R5817:Smc1b	UTSW	15	85067783	missense	probably damaging	0.99
R5834:Smc1b	UTSW	15	85089665	missense	probably damaging	1.00
R5930:Smc1b	UTSW	15	85086121	missense	probably damaging	1.00
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6049:Smc1b	UTSW	15	85121695	missense	probably damaging	1.00
R6306:Smc1b	UTSW	15	85127623	missense	probably benign	0.30
R6392:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6426:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6435:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6436:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6437:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6508:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6512:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6703:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6737:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6775:Smc1b	UTSW	15	85089680	missense	probably damaging	0.96
R6889:Smc1b	UTSW	15	85067759	missense	probably damaging	1.00
R6908:Smc1b	UTSW	15	85107010	missense	probably damaging	1.00
R7124:Smc1b	UTSW	15	85071597	missense	probably damaging	0.98
R7400:Smc1b	UTSW	15	85069720	missense	probably damaging	1.00
R7417:Smc1b	UTSW	15	85097542	missense	probably benign	0.05
R7610:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R7873:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7890:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8004:Smc1b	UTSW	15	85097614	missense	probably damaging	0.98
R8698:Smc1b	UTSW	15	85112846	missense	probably benign	0.16
R8826:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8835:Smc1b	UTSW	15	85129748	missense	possibly damaging	0.83
R8925:Smc1b	UTSW	15	85107072	splice site	probably null
R9059:Smc1b	UTSW	15	85120674	nonsense	probably null
R9149:Smc1b	UTSW	15	85066230	missense	probably benign	0.00
R9241:Smc1b	UTSW	15	85092008	missense	probably benign	0.00
R9245:Smc1b	UTSW	15	85120645	missense	probably benign	0.03
R9301:Smc1b	UTSW	15	85127794	missense	probably damaging	0.98
R9384:Smc1b	UTSW	15	85066254	missense	probably damaging	0.99
R9750:Smc1b	UTSW	15	85131905	missense	probably damaging	1.00
Z1176:Smc1b	UTSW	15	85131903	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTGGCTTTGCACCTATGTTATTA -3'
(R):5'- ACTACTGAAGCACAAATGCCTTCCTT -3'

Sequencing Primer
(F):5'- ggctttgcACCTATGTTATTAAGGAC -3'
(R):5'- gtagaggcaggagcatcag -3'

Posted On

2013-07-30