Incidental Mutation 'R7925:Abca6'
ID611529
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7925 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110196697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1135 (L1135P)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044003
AA Change: L1135P

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: L1135P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nefh CCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,940,972 probably benign Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Rsf1 GGC GGCAACGGCCGC 7: 97,579,906 probably benign Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Zfp970 T C 2: 177,476,001 I456T probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R7938:Abca6 UTSW 11 110191628 missense probably benign 0.01
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTTGTTGCAACCATCACATG -3'
(R):5'- GCAATGGTGGTTGCCCATATATTTG -3'

Sequencing Primer
(F):5'- CCATCACATGAAGTTGGCTG -3'
(R):5'- CAACATGCAGATTACCAGTATGATAC -3'
Posted On2019-12-27