Incidental Mutation 'R0686:Fam102b'
Institutional Source Beutler Lab
Gene Symbol Fam102b
Ensembl Gene ENSMUSG00000040339
Gene Namefamily with sequence similarity 102, member B
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R0686 (G1)
Quality Score87
Status Not validated
Chromosomal Location108970997-109027607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108992685 bp
Amino Acid Change Arginine to Cysteine at position 116 (R116C)
Ref Sequence ENSEMBL: ENSMUSP00000131904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046924] [ENSMUST00000171143]
Predicted Effect probably damaging
Transcript: ENSMUST00000046924
AA Change: R85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039751
Gene: ENSMUSG00000040339
AA Change: R85C

Pfam:NT-C2 1 118 7.7e-24 PFAM
low complexity region 230 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171143
AA Change: R116C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131904
Gene: ENSMUSG00000040339
AA Change: R116C

Pfam:NT-C2 3 149 1.3e-31 PFAM
low complexity region 261 288 N/A INTRINSIC
Meta Mutation Damage Score 0.4597 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Fam102b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Fam102b APN 3 108979785 missense possibly damaging 0.94
IGL02415:Fam102b APN 3 108980292 missense probably damaging 1.00
R0362:Fam102b UTSW 3 108980181 missense probably benign 0.37
R0502:Fam102b UTSW 3 108992685 missense probably damaging 1.00
R0505:Fam102b UTSW 3 108980204 missense probably benign 0.00
R2568:Fam102b UTSW 3 108978848 missense probably benign 0.09
R3721:Fam102b UTSW 3 108979767 missense probably damaging 1.00
R4466:Fam102b UTSW 3 108979808 missense probably benign 0.31
R4613:Fam102b UTSW 3 109027255 missense probably benign 0.12
R4946:Fam102b UTSW 3 108980228 missense probably benign 0.00
R5182:Fam102b UTSW 3 108985351 missense possibly damaging 0.81
R5831:Fam102b UTSW 3 108992703 missense possibly damaging 0.73
R5930:Fam102b UTSW 3 108980152 missense probably benign 0.00
R7432:Fam102b UTSW 3 109003407 missense probably damaging 0.97
R7601:Fam102b UTSW 3 108988312 missense possibly damaging 0.51
R8309:Fam102b UTSW 3 109027342 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-07-30