Incidental Mutation 'R7926:Cstf1'
ID611565
Institutional Source Beutler Lab
Gene Symbol Cstf1
Ensembl Gene ENSMUSG00000027498
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7926 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location172370681-172382448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172378000 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 344 (Y344H)
Ref Sequence ENSEMBL: ENSMUSP00000112076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably damaging
Transcript: ENSMUST00000116375
AA Change: Y344H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498
AA Change: Y344H

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151511
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc191 T A 16: 43,959,336 L777M probably damaging Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cenpe T A 3: 135,232,959 Y517* probably null Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fgfrl1 T A 5: 108,703,618 probably null Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Plek2 T C 12: 78,894,869 probably null Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Rps6ka5 T C 12: 100,553,149 D735G possibly damaging Het
Setx T A 2: 29,173,569 N2292K probably damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vmn2r72 G A 7: 85,749,630 T505I probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Cstf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cstf1 APN 2 172373073 missense probably benign 0.32
IGL02306:Cstf1 APN 2 172372971 missense probably benign 0.02
IGL02553:Cstf1 APN 2 172377854 missense probably benign 0.19
IGL02756:Cstf1 APN 2 172375875 missense probably damaging 1.00
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0244:Cstf1 UTSW 2 172377710 missense possibly damaging 0.87
R1448:Cstf1 UTSW 2 172375875 missense probably damaging 1.00
R1770:Cstf1 UTSW 2 172373063 missense possibly damaging 0.59
R2055:Cstf1 UTSW 2 172380483 missense probably benign 0.00
R2146:Cstf1 UTSW 2 172375763 missense probably damaging 1.00
R3119:Cstf1 UTSW 2 172373070 missense possibly damaging 0.75
R3701:Cstf1 UTSW 2 172380392 missense probably benign 0.00
R4816:Cstf1 UTSW 2 172372985 missense probably damaging 1.00
R4893:Cstf1 UTSW 2 172380524 missense probably damaging 1.00
R4991:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R4992:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R5743:Cstf1 UTSW 2 172377833 missense probably damaging 1.00
R6386:Cstf1 UTSW 2 172377896 missense probably damaging 0.97
R7314:Cstf1 UTSW 2 172373034 missense probably damaging 1.00
R7843:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
X0026:Cstf1 UTSW 2 172375860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGTACGTCACTGGCAG -3'
(R):5'- AAGGGGAACTGAGCTTGTCTTC -3'

Sequencing Primer
(F):5'- TACGTCACTGGCAGCAAGGAC -3'
(R):5'- AACTGAGCTTGTCTTCCTGTCTGAG -3'
Posted On2019-12-27