Incidental Mutation 'R7926:Cenpe'
ID611567
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7926 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 135232959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 517 (Y517*)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably null
Transcript: ENSMUST00000062893
AA Change: Y517*
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: Y517*

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc191 T A 16: 43,959,336 L777M probably damaging Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
Cstf1 T C 2: 172,378,000 Y344H probably damaging Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fgfrl1 T A 5: 108,703,618 probably null Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Plek2 T C 12: 78,894,869 probably null Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Rps6ka5 T C 12: 100,553,149 D735G possibly damaging Het
Setx T A 2: 29,173,569 N2292K probably damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vmn2r72 G A 7: 85,749,630 T505I probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTACCTGTTCCAAGTTAGGGAG -3'
(R):5'- ATAGGCACATGAGAACCAGC -3'

Sequencing Primer
(F):5'- CCTGTTCCAAGTTAGGGAGATTACAC -3'
(R):5'- CACCTCAACCTTAGAAATCAATGTC -3'
Posted On2019-12-27