Incidental Mutation 'R0686:Rasef'
ID 61158
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
MMRRC Submission 038871-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0686 (G1)
Quality Score 133
Status Not validated
Chromosome 4
Chromosomal Location 73632816-73709231 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73652771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 577 (S577P)
Ref Sequence ENSEMBL: ENSMUSP00000152127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably damaging
Transcript: ENSMUST00000058292
AA Change: S496P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: S496P

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102837
AA Change: S424P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: S424P

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222414
AA Change: S577P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik C T 5: 138,562,799 (GRCm39) E42K possibly damaging Het
Arhgef12 A C 9: 42,904,324 (GRCm39) L718R probably benign Het
Bsx T G 9: 40,787,733 (GRCm39) S136A probably damaging Het
Ccne2 T A 4: 11,197,220 (GRCm39) M174K possibly damaging Het
Ces1a A G 8: 93,749,077 (GRCm39) Y445H probably damaging Het
Ckb A G 12: 111,636,627 (GRCm39) V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 133,801,837 (GRCm39) probably benign Het
Cyp2r1 T G 7: 114,151,246 (GRCm39) M358L possibly damaging Het
Dnah10 T C 5: 124,824,782 (GRCm39) I646T possibly damaging Het
Eeig2 G A 3: 108,900,001 (GRCm39) R116C probably damaging Het
Eps8l1 T A 7: 4,480,449 (GRCm39) D563E probably benign Het
Fhip1b G T 7: 105,037,516 (GRCm39) L356I probably damaging Het
Fpr-rs4 A C 17: 18,242,613 (GRCm39) I207L probably benign Het
Fus G A 7: 127,571,935 (GRCm39) probably benign Het
Ireb2 A T 9: 54,811,460 (GRCm39) I755L probably benign Het
Kctd9 A G 14: 67,966,185 (GRCm39) T101A probably damaging Het
Lcor T A 19: 41,570,811 (GRCm39) S1R possibly damaging Het
Ltbr T C 6: 125,285,024 (GRCm39) D292G possibly damaging Het
Med1 G A 11: 98,049,230 (GRCm39) T507I probably damaging Het
Msh3 G A 13: 92,487,939 (GRCm39) P93S possibly damaging Het
Or2ag1 A T 7: 106,313,585 (GRCm39) M101K probably damaging Het
Or8g37 A C 9: 39,730,964 (GRCm39) T10P probably damaging Het
Paqr5 T G 9: 61,880,076 (GRCm39) T59P probably benign Het
Pih1d1 T A 7: 44,805,753 (GRCm39) L74* probably null Het
Prim2 T C 1: 33,553,270 (GRCm39) T264A probably benign Het
Prss59 G A 6: 40,905,452 (GRCm39) S68F probably damaging Het
Simc1 T A 13: 54,673,003 (GRCm39) S450R probably benign Het
Tdrd1 A T 19: 56,844,483 (GRCm39) N796I probably damaging Het
Vmn1r214 T A 13: 23,218,962 (GRCm39) I152N probably damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73,689,662 (GRCm39) nonsense probably null
IGL01329:Rasef APN 4 73,645,882 (GRCm39) missense probably damaging 1.00
IGL01517:Rasef APN 4 73,688,059 (GRCm39) missense probably benign 0.03
IGL02465:Rasef APN 4 73,652,725 (GRCm39) missense probably damaging 1.00
IGL02676:Rasef APN 4 73,677,966 (GRCm39) missense possibly damaging 0.69
IGL03137:Rasef APN 4 73,652,720 (GRCm39) nonsense probably null
IGL03403:Rasef APN 4 73,652,771 (GRCm39) missense probably damaging 1.00
BB001:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
BB011:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
P0033:Rasef UTSW 4 73,668,089 (GRCm39) missense probably benign 0.26
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0317:Rasef UTSW 4 73,666,799 (GRCm39) missense probably damaging 1.00
R0987:Rasef UTSW 4 73,652,721 (GRCm39) nonsense probably null
R1115:Rasef UTSW 4 73,666,841 (GRCm39) missense possibly damaging 0.85
R1511:Rasef UTSW 4 73,653,985 (GRCm39) missense probably damaging 1.00
R1585:Rasef UTSW 4 73,658,574 (GRCm39) missense probably damaging 1.00
R1646:Rasef UTSW 4 73,652,786 (GRCm39) missense probably damaging 1.00
R1705:Rasef UTSW 4 73,662,301 (GRCm39) nonsense probably null
R1918:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R1919:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R3819:Rasef UTSW 4 73,677,942 (GRCm39) missense probably damaging 1.00
R3891:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R3892:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R4344:Rasef UTSW 4 73,663,326 (GRCm39) missense probably damaging 1.00
R4491:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4492:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4594:Rasef UTSW 4 73,698,626 (GRCm39) missense possibly damaging 0.47
R4915:Rasef UTSW 4 73,649,696 (GRCm39) missense probably damaging 1.00
R5276:Rasef UTSW 4 73,654,004 (GRCm39) missense probably null 1.00
R5359:Rasef UTSW 4 73,689,565 (GRCm39) missense probably damaging 1.00
R5682:Rasef UTSW 4 73,659,208 (GRCm39) nonsense probably null
R5693:Rasef UTSW 4 73,688,076 (GRCm39) missense probably damaging 0.99
R6414:Rasef UTSW 4 73,658,818 (GRCm39) missense probably benign 0.13
R6543:Rasef UTSW 4 73,698,756 (GRCm39) intron probably benign
R6593:Rasef UTSW 4 73,663,327 (GRCm39) missense probably damaging 1.00
R7078:Rasef UTSW 4 73,698,626 (GRCm39) missense probably benign 0.01
R7083:Rasef UTSW 4 73,709,221 (GRCm39) missense probably benign 0.26
R7106:Rasef UTSW 4 73,645,864 (GRCm39) missense probably damaging 1.00
R7127:Rasef UTSW 4 73,662,369 (GRCm39) missense probably damaging 1.00
R7329:Rasef UTSW 4 73,662,374 (GRCm39) missense probably damaging 1.00
R7767:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R7891:Rasef UTSW 4 73,709,201 (GRCm39) missense probably benign
R7891:Rasef UTSW 4 73,677,935 (GRCm39) missense probably benign 0.00
R7924:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
R7997:Rasef UTSW 4 73,658,799 (GRCm39) missense possibly damaging 0.78
R8554:Rasef UTSW 4 73,645,844 (GRCm39) missense probably benign 0.03
R8832:Rasef UTSW 4 73,698,558 (GRCm39) intron probably benign
R8850:Rasef UTSW 4 73,645,840 (GRCm39) missense probably damaging 1.00
R8985:Rasef UTSW 4 73,708,960 (GRCm39) missense possibly damaging 0.48
R9093:Rasef UTSW 4 73,698,583 (GRCm39) missense probably benign 0.00
R9179:Rasef UTSW 4 73,662,356 (GRCm39) missense probably damaging 0.97
R9199:Rasef UTSW 4 73,658,625 (GRCm39) missense possibly damaging 0.88
R9300:Rasef UTSW 4 73,659,393 (GRCm39) missense probably benign
R9310:Rasef UTSW 4 73,653,956 (GRCm39) critical splice donor site probably null
R9415:Rasef UTSW 4 73,645,882 (GRCm39) missense probably benign 0.00
R9482:Rasef UTSW 4 73,708,933 (GRCm39) missense probably benign 0.00
R9719:Rasef UTSW 4 73,688,102 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GACAGCTCATGCCTCCCTTGAATAG -3'
(R):5'- TCTTGGTCACTACAGATTTCACCGC -3'

Sequencing Primer
(F):5'- ATGCCTCCCTTGAATAGGTTTC -3'
(R):5'- CTGGACAAAGGATAGGCTTCTTC -3'
Posted On 2013-07-30