Mutagenetix > Incidental Mutations

Incidental Mutation 'R0686:Dnah10'

61160

Institutional Source

Beutler Lab

Gene Symbol

Dnah10

Ensembl Gene

ENSMUSG00000038011

Gene Name

dynein, axonemal, heavy chain 10

Synonyms

Dnahc10

MMRRC Submission

038871-MU

Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0686 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

124725085-124834308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124747718 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 646 (I646T)

Ref Sequence

ENSEMBL: ENSMUSP00000062995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058440
AA Change: I646T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: I646T

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	305	878	9.1e-154	PFAM
coiled coil region	1191	1218	N/A	INTRINSIC
coiled coil region	1337	1360	N/A	INTRINSIC
Pfam:DHC_N2	1374	1782	1.7e-142	PFAM
AAA	1946	2082	2.51e-1	SMART
AAA	2225	2373	6.91e-1	SMART
low complexity region	2444	2464	N/A	INTRINSIC
AAA	2567	2720	2.29e-2	SMART
Pfam:AAA_8	2886	3153	9.8e-87	PFAM
Pfam:MT	3165	3502	9.1e-53	PFAM
Pfam:AAA_9	3522	3747	2.3e-90	PFAM
Pfam:Dynein_heavy	3884	4588	7.6e-240	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141137

SMART Domains

Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	304	607	4.3e-57	PFAM
Pfam:DHC_N1	598	823	1.2e-39	PFAM
coiled coil region	1134	1161	N/A	INTRINSIC
coiled coil region	1280	1303	N/A	INTRINSIC
Pfam:DHC_N2	1315	1727	7.3e-135	PFAM
AAA	1889	2025	4e-3	SMART
AAA	2168	2316	1.1e-2	SMART
low complexity region	2387	2407	N/A	INTRINSIC
AAA	2510	2663	3.6e-4	SMART
Pfam:AAA_8	2829	3096	2.5e-83	PFAM
Pfam:MT	3108	3445	1.2e-50	PFAM
Pfam:AAA_9	3461	3691	6.7e-59	PFAM
Pfam:Dynein_heavy	3821	4532	1.9e-231	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	G	A	6: 40,928,518	S68F	probably damaging	Het
1700123K08Rik	C	T	5: 138,564,537	E42K	possibly damaging	Het
Arhgef12	A	C	9: 42,993,028	L718R	probably benign	Het
Bsx	T	G	9: 40,876,437	S136A	probably damaging	Het
Ccne2	T	A	4: 11,197,220	M174K	possibly damaging	Het
Ces1a	A	G	8: 93,022,449	Y445H	probably damaging	Het
Ckb	A	G	12: 111,670,193	V249A	probably benign	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Cyp2r1	T	G	7: 114,552,011	M358L	possibly damaging	Het
Eps8l1	T	A	7: 4,477,450	D563E	probably benign	Het
Fam102b	G	A	3: 108,992,685	R116C	probably damaging	Het
Fam160a2	G	T	7: 105,388,309	L356I	probably damaging	Het
Fpr-rs4	A	C	17: 18,022,351	I207L	probably benign	Het
Fus	G	A	7: 127,972,763		probably benign	Het
Gm340	T	A	19: 41,582,372	S1R	possibly damaging	Het
Ireb2	A	T	9: 54,904,176	I755L	probably benign	Het
Kctd9	A	G	14: 67,728,736	T101A	probably damaging	Het
Ltbr	T	C	6: 125,308,061	D292G	possibly damaging	Het
Med1	G	A	11: 98,158,404	T507I	probably damaging	Het
Msh3	G	A	13: 92,351,431	P93S	possibly damaging	Het
Olfr705	A	T	7: 106,714,378	M101K	probably damaging	Het
Olfr970	A	C	9: 39,819,668	T10P	probably damaging	Het
Paqr5	T	G	9: 61,972,794	T59P	probably benign	Het
Pih1d1	T	A	7: 45,156,329	L74*	probably null	Het
Prim2	T	C	1: 33,514,189	T264A	probably benign	Het
Rasef	A	G	4: 73,734,534	S577P	probably damaging	Het
Simc1	T	A	13: 54,525,190	S450R	probably benign	Het
Tdrd1	A	T	19: 56,856,051	N796I	probably damaging	Het
Vmn1r214	T	A	13: 23,034,792	I152N	probably damaging	Het

Other mutations in Dnah10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dnah10	APN	5	124828603	missense	probably damaging	1.00
IGL00089:Dnah10	APN	5	124746616	missense	probably benign	0.01
IGL00471:Dnah10	APN	5	124794341	missense	probably damaging	1.00
IGL01336:Dnah10	APN	5	124775512	missense	probably damaging	1.00
IGL01339:Dnah10	APN	5	124777212	missense	probably damaging	1.00
IGL01372:Dnah10	APN	5	124779154	missense	probably damaging	1.00
IGL01572:Dnah10	APN	5	124783946	missense	probably damaging	1.00
IGL01634:Dnah10	APN	5	124821341	missense	probably damaging	0.98
IGL01649:Dnah10	APN	5	124732489	missense	probably damaging	0.97
IGL01676:Dnah10	APN	5	124803328	missense	possibly damaging	0.65
IGL01729:Dnah10	APN	5	124787465	missense	probably benign	0.10
IGL01757:Dnah10	APN	5	124768927	missense	probably benign	0.37
IGL01759:Dnah10	APN	5	124755786	missense	probably benign
IGL01767:Dnah10	APN	5	124743737	splice site	probably benign
IGL01769:Dnah10	APN	5	124764944	missense	possibly damaging	0.63
IGL01805:Dnah10	APN	5	124783921	missense	probably damaging	1.00
IGL02090:Dnah10	APN	5	124789812	missense	probably damaging	1.00
IGL02162:Dnah10	APN	5	124804746	missense	probably damaging	1.00
IGL02312:Dnah10	APN	5	124819366	missense	probably damaging	1.00
IGL02347:Dnah10	APN	5	124833423	critical splice acceptor site	probably null
IGL02378:Dnah10	APN	5	124773067	missense	probably damaging	1.00
IGL02440:Dnah10	APN	5	124773819	missense	probably damaging	1.00
IGL02457:Dnah10	APN	5	124789796	missense	probably damaging	1.00
IGL02487:Dnah10	APN	5	124793852	missense	possibly damaging	0.90
IGL02502:Dnah10	APN	5	124821287	missense	probably damaging	1.00
IGL02516:Dnah10	APN	5	124787331	missense	probably damaging	1.00
IGL02544:Dnah10	APN	5	124799005	missense	probably benign	0.26
IGL02709:Dnah10	APN	5	124773745	nonsense	probably null
IGL02740:Dnah10	APN	5	124826863	splice site	probably benign
IGL02746:Dnah10	APN	5	124730086	missense	possibly damaging	0.55
IGL02803:Dnah10	APN	5	124798014	missense	probably damaging	0.99
IGL02900:Dnah10	APN	5	124801822	missense	probably damaging	1.00
IGL02957:Dnah10	APN	5	124763133	missense	probably benign	0.07
IGL03076:Dnah10	APN	5	124730162	critical splice donor site	probably null
IGL03109:Dnah10	APN	5	124764886	missense	probably benign	0.10
IGL03181:Dnah10	APN	5	124748457	missense	probably damaging	0.99
IGL03185:Dnah10	APN	5	124817643	missense	probably damaging	1.00
IGL03199:Dnah10	APN	5	124817697	missense	probably benign	0.00
IGL03328:Dnah10	APN	5	124754290	missense	probably benign	0.06
frosty	UTSW	5	124828137	missense	probably damaging	1.00
H8562:Dnah10	UTSW	5	124829529	missense	probably damaging	1.00
I2288:Dnah10	UTSW	5	124730100	missense	probably benign
P0019:Dnah10	UTSW	5	124763066	missense	probably benign
P0037:Dnah10	UTSW	5	124817992	nonsense	probably null
PIT4366001:Dnah10	UTSW	5	124775524	missense	possibly damaging	0.95
R0004:Dnah10	UTSW	5	124726902	missense	probably benign
R0032:Dnah10	UTSW	5	124800891	missense	possibly damaging	0.94
R0032:Dnah10	UTSW	5	124800891	missense	possibly damaging	0.94
R0050:Dnah10	UTSW	5	124830744	missense	probably benign	0.00
R0066:Dnah10	UTSW	5	124763076	missense	probably benign	0.01
R0164:Dnah10	UTSW	5	124783834	missense	probably damaging	1.00
R0164:Dnah10	UTSW	5	124783834	missense	probably damaging	1.00
R0196:Dnah10	UTSW	5	124834075	missense	possibly damaging	0.80
R0312:Dnah10	UTSW	5	124796369	splice site	probably benign
R0321:Dnah10	UTSW	5	124823352	missense	probably benign	0.29
R0410:Dnah10	UTSW	5	124755735	missense	probably benign
R0480:Dnah10	UTSW	5	124808851	missense	probably damaging	1.00
R0531:Dnah10	UTSW	5	124812723	critical splice donor site	probably null
R0533:Dnah10	UTSW	5	124775250	splice site	probably null
R0599:Dnah10	UTSW	5	124800953	missense	probably damaging	1.00
R0688:Dnah10	UTSW	5	124747718	missense	possibly damaging	0.95
R0780:Dnah10	UTSW	5	124750812	missense	possibly damaging	0.87
R0968:Dnah10	UTSW	5	124829577	missense	probably damaging	0.99
R0989:Dnah10	UTSW	5	124797938	missense	probably benign	0.00
R1203:Dnah10	UTSW	5	124760014	splice site	probably null
R1248:Dnah10	UTSW	5	124755823	splice site	probably benign
R1366:Dnah10	UTSW	5	124753326	missense	probably benign	0.41
R1434:Dnah10	UTSW	5	124774986	missense	probably benign	0.03
R1436:Dnah10	UTSW	5	124762221	missense	probably benign	0.00
R1438:Dnah10	UTSW	5	124798945	missense	probably benign	0.25
R1446:Dnah10	UTSW	5	124789796	missense	probably damaging	1.00
R1459:Dnah10	UTSW	5	124743686	missense	possibly damaging	0.90
R1466:Dnah10	UTSW	5	124763096	missense	probably benign
R1466:Dnah10	UTSW	5	124763096	missense	probably benign
R1479:Dnah10	UTSW	5	124777889	missense	possibly damaging	0.71
R1505:Dnah10	UTSW	5	124754239	missense	possibly damaging	0.82
R1519:Dnah10	UTSW	5	124760952	missense	probably damaging	0.98
R1565:Dnah10	UTSW	5	124829614	missense	probably damaging	1.00
R1668:Dnah10	UTSW	5	124765562	missense	probably benign	0.00
R1709:Dnah10	UTSW	5	124760091	missense	probably damaging	0.99
R1740:Dnah10	UTSW	5	124773190	splice site	probably null
R1828:Dnah10	UTSW	5	124761279	missense	probably benign	0.00
R1854:Dnah10	UTSW	5	124804689	missense	probably damaging	0.99
R1865:Dnah10	UTSW	5	124832526	splice site	probably null
R1893:Dnah10	UTSW	5	124754317	missense	probably benign	0.13
R1895:Dnah10	UTSW	5	124758430	missense	probably benign	0.00
R1906:Dnah10	UTSW	5	124800984	missense	probably damaging	1.00
R1953:Dnah10	UTSW	5	124782268	missense	probably benign	0.00
R1965:Dnah10	UTSW	5	124775203	missense	probably damaging	1.00
R2002:Dnah10	UTSW	5	124833988	missense	probably damaging	1.00
R2006:Dnah10	UTSW	5	124829587	missense	possibly damaging	0.58
R2037:Dnah10	UTSW	5	124746704	missense	probably benign	0.30
R2046:Dnah10	UTSW	5	124796341	missense	probably benign	0.25
R2074:Dnah10	UTSW	5	124814674	missense	probably damaging	1.00
R2081:Dnah10	UTSW	5	124774981	missense	possibly damaging	0.88
R2257:Dnah10	UTSW	5	124761237	missense	probably damaging	1.00
R2272:Dnah10	UTSW	5	124731466	missense	probably benign	0.00
R2293:Dnah10	UTSW	5	124819221	missense	probably damaging	0.97
R2323:Dnah10	UTSW	5	124742000	missense	probably damaging	1.00
R2435:Dnah10	UTSW	5	124762865	critical splice donor site	probably null
R2571:Dnah10	UTSW	5	124775478	missense	probably damaging	1.00
R2898:Dnah10	UTSW	5	124817670	missense	probably damaging	1.00
R2937:Dnah10	UTSW	5	124819412	critical splice donor site	probably null
R3439:Dnah10	UTSW	5	124796258	missense	possibly damaging	0.91
R3548:Dnah10	UTSW	5	124747630	missense	possibly damaging	0.50
R3881:Dnah10	UTSW	5	124773031	missense	probably benign	0.37
R4015:Dnah10	UTSW	5	124777926	missense	probably benign	0.25
R4261:Dnah10	UTSW	5	124730137	missense	possibly damaging	0.95
R4277:Dnah10	UTSW	5	124732330	missense	probably benign	0.28
R4299:Dnah10	UTSW	5	124819925	missense	probably damaging	1.00
R4613:Dnah10	UTSW	5	124762869	splice site	probably null
R4651:Dnah10	UTSW	5	124729143	missense	probably benign	0.20
R4652:Dnah10	UTSW	5	124729143	missense	probably benign	0.20
R4664:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4665:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4666:Dnah10	UTSW	5	124828472	missense	possibly damaging	0.95
R4691:Dnah10	UTSW	5	124775517	missense	probably damaging	1.00
R4755:Dnah10	UTSW	5	124747745	missense	probably benign	0.01
R4806:Dnah10	UTSW	5	124819344	missense	probably damaging	1.00
R4839:Dnah10	UTSW	5	124773132	missense	probably damaging	1.00
R4903:Dnah10	UTSW	5	124817748	missense	probably damaging	1.00
R5018:Dnah10	UTSW	5	124762196	missense	possibly damaging	0.79
R5101:Dnah10	UTSW	5	124832513	missense	possibly damaging	0.51
R5105:Dnah10	UTSW	5	124811482	missense	probably benign	0.01
R5119:Dnah10	UTSW	5	124779258	missense	probably damaging	1.00
R5139:Dnah10	UTSW	5	124798960	missense	probably damaging	0.99
R5242:Dnah10	UTSW	5	124787420	missense	probably benign	0.00
R5262:Dnah10	UTSW	5	124785156	missense	probably damaging	1.00
R5277:Dnah10	UTSW	5	124828137	missense	probably damaging	1.00
R5293:Dnah10	UTSW	5	124791787	missense	probably benign	0.01
R5322:Dnah10	UTSW	5	124773566	missense	probably damaging	1.00
R5371:Dnah10	UTSW	5	124743629	missense	probably benign	0.16
R5468:Dnah10	UTSW	5	124830493	missense	probably damaging	1.00
R5470:Dnah10	UTSW	5	124753168	missense	probably benign
R5587:Dnah10	UTSW	5	124793913	missense	probably benign	0.10
R5724:Dnah10	UTSW	5	124742026	missense	probably benign	0.27
R5797:Dnah10	UTSW	5	124821386	missense	probably benign	0.00
R5812:Dnah10	UTSW	5	124747746	missense	probably benign	0.01
R5846:Dnah10	UTSW	5	124823373	missense	possibly damaging	0.80
R5930:Dnah10	UTSW	5	124791791	critical splice donor site	probably null
R5961:Dnah10	UTSW	5	124811482	missense	probably benign	0.01
R5970:Dnah10	UTSW	5	124808729	missense	probably benign
R6021:Dnah10	UTSW	5	124736984	missense	probably damaging	1.00
R6043:Dnah10	UTSW	5	124801860	missense	probably damaging	1.00
R6073:Dnah10	UTSW	5	124819210	missense	probably benign	0.09
R6080:Dnah10	UTSW	5	124805897	missense	possibly damaging	0.71
R6093:Dnah10	UTSW	5	124753174	missense	probably benign	0.18
R6155:Dnah10	UTSW	5	124770599	missense	probably damaging	1.00
R6155:Dnah10	UTSW	5	124785175	missense	probably damaging	1.00
R6162:Dnah10	UTSW	5	124823318	missense	probably benign	0.02
R6238:Dnah10	UTSW	5	124743679	missense	probably damaging	0.97
R6248:Dnah10	UTSW	5	124794219	splice site	probably null
R6275:Dnah10	UTSW	5	124785184	missense	probably damaging	1.00
R6297:Dnah10	UTSW	5	124775080	missense	possibly damaging	0.55
R6388:Dnah10	UTSW	5	124829646	missense	probably benign	0.00
R6458:Dnah10	UTSW	5	124809269	missense	probably damaging	1.00
R6504:Dnah10	UTSW	5	124762782	missense	possibly damaging	0.50
R6518:Dnah10	UTSW	5	124758355	missense	probably damaging	0.99
R6627:Dnah10	UTSW	5	124830033	missense	probably damaging	1.00
R6701:Dnah10	UTSW	5	124760159	missense	probably benign	0.45
R6702:Dnah10	UTSW	5	124805805	missense	probably damaging	1.00
R6745:Dnah10	UTSW	5	124808812	missense	probably damaging	1.00
R6784:Dnah10	UTSW	5	124777826	missense	probably damaging	0.99
R6807:Dnah10	UTSW	5	124790000	splice site	probably null
R6932:Dnah10	UTSW	5	124821450	missense	possibly damaging	0.75
R7007:Dnah10	UTSW	5	124787426	missense	probably damaging	1.00
R7091:Dnah10	UTSW	5	124816142	missense	probably benign	0.37
R7138:Dnah10	UTSW	5	124822945	missense	probably damaging	1.00
R7144:Dnah10	UTSW	5	124822942	missense	probably damaging	0.98
R7231:Dnah10	UTSW	5	124813828	missense	probably benign	0.19
R7278:Dnah10	UTSW	5	124791791	critical splice donor site	probably null
R7284:Dnah10	UTSW	5	124832598	missense	probably benign	0.37
R7322:Dnah10	UTSW	5	124821269	missense	probably benign	0.08
R7523:Dnah10	UTSW	5	124747739	missense	probably damaging	0.97
R7565:Dnah10	UTSW	5	124799031	missense	probably damaging	1.00
R7593:Dnah10	UTSW	5	124746544	missense	probably benign	0.21
R7606:Dnah10	UTSW	5	124817712	missense	probably benign	0.00
R7835:Dnah10	UTSW	5	124777234	missense	probably damaging	1.00
R7898:Dnah10	UTSW	5	124782361	missense	probably damaging	1.00
R7972:Dnah10	UTSW	5	124726885	missense	probably benign
R7999:Dnah10	UTSW	5	124725258	missense	probably benign	0.06
R8017:Dnah10	UTSW	5	124800885	missense	probably benign	0.03
R8032:Dnah10	UTSW	5	124746612	missense	probably damaging	0.98
R8052:Dnah10	UTSW	5	124828511	missense	probably benign	0.00
R8088:Dnah10	UTSW	5	124754266	missense	probably benign	0.00
R8169:Dnah10	UTSW	5	124800882	missense	probably damaging	1.00
R8178:Dnah10	UTSW	5	124755726	missense	probably benign	0.11
R8200:Dnah10	UTSW	5	124828460	missense	probably damaging	1.00
R8210:Dnah10	UTSW	5	124750794	missense	probably benign	0.29
R8294:Dnah10	UTSW	5	124782346	missense	probably damaging	1.00
R8338:Dnah10	UTSW	5	124832502	missense	probably damaging	1.00
R8404:Dnah10	UTSW	5	124773542	missense	probably damaging	1.00
R8469:Dnah10	UTSW	5	124736831	missense	probably damaging	1.00
R8537:Dnah10	UTSW	5	124816100	missense	probably damaging	0.97
R8723:Dnah10	UTSW	5	124814621	missense	probably damaging	0.99
R8770:Dnah10	UTSW	5	124775346	missense	possibly damaging	0.94
RF015:Dnah10	UTSW	5	124818077	missense	probably damaging	1.00
RF021:Dnah10	UTSW	5	124777907	missense	probably damaging	1.00
T0975:Dnah10	UTSW	5	124763066	missense	probably benign
U24488:Dnah10	UTSW	5	124813980	missense	probably damaging	1.00
X0017:Dnah10	UTSW	5	124765697	missense	probably benign	0.22
Z1176:Dnah10	UTSW	5	124775355	missense	probably benign	0.11
Z1177:Dnah10	UTSW	5	124741955	missense	probably damaging	1.00
Z1177:Dnah10	UTSW	5	124747619	missense	possibly damaging	0.64
Z1177:Dnah10	UTSW	5	124817988	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTCATTACTACGCAACAGAGCCCTG -3'
(R):5'- ATCTAGAGGTGACCACTGGCAGAC -3'

Sequencing Primer
(F):5'- AACAGAGCCCTGTTGGTC -3'
(R):5'- CTGGCAGACATTACATTTTAGAGGG -3'

Posted On

2013-07-30