Incidental Mutation 'R7926:Rps6ka5'
ID611603
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7926 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100553149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 735 (D735G)
Ref Sequence ENSEMBL: ENSMUSP00000042987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043599
AA Change: D735G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: D735G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000222731
AA Change: D670G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc191 T A 16: 43,959,336 L777M probably damaging Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cenpe T A 3: 135,232,959 Y517* probably null Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
Cstf1 T C 2: 172,378,000 Y344H probably damaging Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fgfrl1 T A 5: 108,703,618 probably null Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Plek2 T C 12: 78,894,869 probably null Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Setx T A 2: 29,173,569 N2292K probably damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vmn2r72 G A 7: 85,749,630 T505I probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5660:Rps6ka5 UTSW 12 100619580 missense possibly damaging 0.95
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAACACATGGTTCAGAGCC -3'
(R):5'- TAAAATCCAGGGTCCTCAAGC -3'

Sequencing Primer
(F):5'- CACATGGTTCAGAGCCTTTTTAAGC -3'
(R):5'- TCCAGGGTCCTCAAGCAGATTTAG -3'
Posted On2019-12-27