Incidental Mutation 'R7927:Pigu'
ID611627
Institutional Source Beutler Lab
Gene Symbol Pigu
Ensembl Gene ENSMUSG00000038383
Gene Namephosphatidylinositol glycan anchor biosynthesis, class U
SynonymsCdc91l1, 5430426F17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7927 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155278243-155357430 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 155292720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 388 (Y388*)
Ref Sequence ENSEMBL: ENSMUSP00000076816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect probably null
Transcript: ENSMUST00000077626
AA Change: Y388*
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383
AA Change: Y388*

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165234
AA Change: Y387*
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383
AA Change: Y387*

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Slc30a6 G A 17: 74,404,093 probably null Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Pigu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Pigu APN 2 155331192 missense possibly damaging 0.70
IGL02833:Pigu APN 2 155345645 splice site probably benign
IGL03213:Pigu APN 2 155335371 missense probably damaging 1.00
R1645:Pigu UTSW 2 155328678 nonsense probably null
R2426:Pigu UTSW 2 155299082 missense probably damaging 1.00
R3816:Pigu UTSW 2 155299143 missense probably damaging 1.00
R3879:Pigu UTSW 2 155299143 missense probably damaging 1.00
R5017:Pigu UTSW 2 155299208 intron probably null
R5215:Pigu UTSW 2 155335329 intron probably benign
R5557:Pigu UTSW 2 155278629 nonsense probably null
R6106:Pigu UTSW 2 155297196 missense possibly damaging 0.67
R6718:Pigu UTSW 2 155301286 missense possibly damaging 0.49
R7140:Pigu UTSW 2 155301240 missense possibly damaging 0.78
R7358:Pigu UTSW 2 155299170 missense probably damaging 1.00
R7467:Pigu UTSW 2 155299089 missense probably damaging 1.00
R7503:Pigu UTSW 2 155331144 splice site probably null
R7844:Pigu UTSW 2 155292720 nonsense probably null
Z1177:Pigu UTSW 2 155299148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAAGTGAGATCAAAGGC -3'
(R):5'- TCCTAGCACACAGTGTTCTGG -3'

Sequencing Primer
(F):5'- CAGAGGAACTGCCACCCC -3'
(R):5'- GCCTTTGAGCCATCTGAGC -3'
Posted On2019-12-27