Incidental Mutation 'R0686:Pih1d1'
ID61167
Institutional Source Beutler Lab
Gene Symbol Pih1d1
Ensembl Gene ENSMUSG00000003423
Gene NamePIH1 domain containing 1
Synonyms1110061L23Rik, 4933413A04Rik, Nop17
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R0686 (G1)
Quality Score97
Status Not validated
Chromosome7
Chromosomal Location45154303-45160065 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 45156329 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 74 (L74*)
Ref Sequence ENSEMBL: ENSMUSP00000147567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085375] [ENSMUST00000107811] [ENSMUST00000107815] [ENSMUST00000209847] [ENSMUST00000209954] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000210139] [ENSMUST00000211362] [ENSMUST00000211414] [ENSMUST00000211709]
Predicted Effect probably null
Transcript: ENSMUST00000085375
AA Change: L7*
SMART Domains Protein: ENSMUSP00000082490
Gene: ENSMUSG00000003423
AA Change: L7*

DomainStartEndE-ValueType
Pfam:PIH1 23 207 1.8e-50 PFAM
Pfam:PIH1 211 285 2.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107811
AA Change: L7*
SMART Domains Protein: ENSMUSP00000103441
Gene: ENSMUSG00000003423
AA Change: L7*

DomainStartEndE-ValueType
Pfam:PIH1 23 207 1.8e-50 PFAM
Pfam:PIH1 211 285 2.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107813
AA Change: L7*
SMART Domains Protein: ENSMUSP00000103443
Gene: ENSMUSG00000003423
AA Change: L7*

DomainStartEndE-ValueType
Pfam:PIH1 22 209 7.6e-39 PFAM
Pfam:PIH1 205 285 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect probably null
Transcript: ENSMUST00000209847
AA Change: L7*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably null
Transcript: ENSMUST00000209954
AA Change: L7*
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect probably null
Transcript: ENSMUST00000210139
AA Change: L7*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211336
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect probably null
Transcript: ENSMUST00000211414
AA Change: L7*
Predicted Effect probably null
Transcript: ENSMUST00000211709
AA Change: L74*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Pih1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pih1d1 APN 7 45159964 missense probably damaging 1.00
IGL01327:Pih1d1 APN 7 45159975 missense probably benign 0.00
IGL02011:Pih1d1 APN 7 45156732 missense probably damaging 1.00
IGL03145:Pih1d1 APN 7 45159121 critical splice donor site probably null
R0659:Pih1d1 UTSW 7 45159975 missense probably benign 0.06
R0845:Pih1d1 UTSW 7 45159682 missense probably benign 0.37
R0848:Pih1d1 UTSW 7 45157617 missense probably damaging 1.00
R1679:Pih1d1 UTSW 7 45159826 critical splice donor site probably null
R1894:Pih1d1 UTSW 7 45157741 missense probably damaging 1.00
R4467:Pih1d1 UTSW 7 45158497 missense possibly damaging 0.78
R4899:Pih1d1 UTSW 7 45154527 intron probably benign
R5033:Pih1d1 UTSW 7 45154854 unclassified probably benign
R5435:Pih1d1 UTSW 7 45156272 unclassified probably null
R6037:Pih1d1 UTSW 7 45156314 missense probably damaging 0.98
R6037:Pih1d1 UTSW 7 45156314 missense probably damaging 0.98
R6145:Pih1d1 UTSW 7 45159044 missense probably damaging 0.99
R6564:Pih1d1 UTSW 7 45159819 missense probably damaging 1.00
R7557:Pih1d1 UTSW 7 45156759 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGAGCCTTCATCGTAATGGAAC -3'
(R):5'- ACTGAAGCCACATCTCTGAGTGCC -3'

Sequencing Primer
(F):5'- acaaagcattccagggcag -3'
(R):5'- TAAATACCCAGGTTCCCACCAG -3'
Posted On2013-07-30