Incidental Mutation 'R7928:Mrps28'
ID611684
Institutional Source Beutler Lab
Gene Symbol Mrps28
Ensembl Gene ENSMUSG00000040269
Gene Namemitochondrial ribosomal protein S28
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location8802146-8923918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8923715 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 28 (N28Y)
Ref Sequence ENSEMBL: ENSMUSP00000038305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042148] [ENSMUST00000091355] [ENSMUST00000120143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042148
AA Change: N28Y

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038305
Gene: ENSMUSG00000040269
AA Change: N28Y

DomainStartEndE-ValueType
S1 94 158 1.69e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091355
SMART Domains Protein: ENSMUSP00000088914
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 185 7.5e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120143
SMART Domains Protein: ENSMUSP00000112830
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 171 2.4e-71 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has been called mitochondrial ribosomal protein S35 in the literature. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Mrps28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Mrps28 APN 3 8900070 missense probably damaging 1.00
IGL01895:Mrps28 APN 3 8900059 missense probably damaging 1.00
R1423:Mrps28 UTSW 3 8900124 missense probably benign 0.00
R1462:Mrps28 UTSW 3 8900124 missense possibly damaging 0.50
R1462:Mrps28 UTSW 3 8900124 missense possibly damaging 0.50
R3034:Mrps28 UTSW 3 8923615 missense probably benign 0.03
R4917:Mrps28 UTSW 3 8882554 intron probably benign
R4918:Mrps28 UTSW 3 8882554 intron probably benign
R5119:Mrps28 UTSW 3 8923696 missense possibly damaging 0.77
R6012:Mrps28 UTSW 3 8899984 critical splice donor site probably null
R6029:Mrps28 UTSW 3 8923745 missense possibly damaging 0.56
R6229:Mrps28 UTSW 3 8900037 missense probably damaging 1.00
R6459:Mrps28 UTSW 3 8899980 splice site probably null
R7845:Mrps28 UTSW 3 8923715 missense possibly damaging 0.48
Z1177:Mrps28 UTSW 3 8923746 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCTAAGTCACCGGCATAG -3'
(R):5'- AAACTACCGGACTAGTAGGCTC -3'

Sequencing Primer
(F):5'- GCCCATGACAAGAAGGACAGAATTC -3'
(R):5'- AGGCTCGCCTGGGATTAAG -3'
Posted On2019-12-27