Incidental Mutation 'R7928:Bglap2'
ID611685
Institutional Source Beutler Lab
Gene Symbol Bglap2
Ensembl Gene ENSMUSG00000074486
Gene Namebone gamma-carboxyglutamate protein 2
SynonymsmOC-B, OG2, bone Gla protein, osteocalcin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88377736-88378699 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 88378694 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076048] [ENSMUST00000098956]
Predicted Effect probably benign
Transcript: ENSMUST00000076048
SMART Domains Protein: ENSMUSP00000075425
Gene: ENSMUSG00000074483

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098956
SMART Domains Protein: ENSMUSP00000096555
Gene: ENSMUSG00000074486

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a hormone that is secreted by osteoblasts and may function in bone remodeling and energy metabolism. Homozygous knockout mice for this gene exhibit a gradual increase in bone size, density and strength, as well as elevated adiposity and impaired glucose tolerance. This gene is present in a gene cluster with other related genes on chromosome 3. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of both Bglap1 and Bglap2 exhibit decreased circulating insulin, impaired glucose tolerance, increased adipose tissue, increased bone density, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Bglap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Bglap2 APN 3 88377936 nonsense probably null
IGL02739:Bglap2 APN 3 88378012 splice site probably null
R0402:Bglap2 UTSW 3 88378245 missense probably damaging 1.00
R0694:Bglap2 UTSW 3 88378416 missense possibly damaging 0.64
R1846:Bglap2 UTSW 3 88378625 unclassified probably benign
R5114:Bglap2 UTSW 3 88382125 unclassified probably benign
R7331:Bglap2 UTSW 3 88378260 missense possibly damaging 0.94
R7677:Bglap2 UTSW 3 88377973 missense probably damaging 1.00
R7696:Bglap2 UTSW 3 88378616 missense unknown
R7845:Bglap2 UTSW 3 88378694 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCCATCCCAAAGCAGATTG -3'
(R):5'- GTTCTTGTCTCTAGGGCGAC -3'

Sequencing Primer
(F):5'- CAAAGCAGATTGTGAGACCTTC -3'
(R):5'- CCTGGCAGTCTCCGATTGTG -3'
Posted On2019-12-27