Incidental Mutation 'R0686:Olfr705'
ID61169
Institutional Source Beutler Lab
Gene Symbol Olfr705
Ensembl Gene ENSMUSG00000109058
Gene Nameolfactory receptor 705
SynonymsGA_x6K02T2PBJ9-9256348-9255398, MOR283-2
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0686 (G1)
Quality Score174
Status Not validated
Chromosome7
Chromosomal Location106871870-106876891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106714378 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 101 (M101K)
Ref Sequence ENSEMBL: ENSMUSP00000149773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080925] [ENSMUST00000216868]
AlphaFold Q9EPF7
Predicted Effect probably damaging
Transcript: ENSMUST00000080925
AA Change: M101K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079726
Gene: ENSMUSG00000073900
AA Change: M101K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216868
AA Change: M101K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Olfr705
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Olfr705 APN 7 106714334 missense possibly damaging 0.48
IGL02203:Olfr705 APN 7 106714630 missense probably benign 0.02
IGL02342:Olfr705 APN 7 106714025 missense probably benign 0.13
IGL02544:Olfr705 APN 7 106714535 missense probably benign 0.39
IGL02569:Olfr705 APN 7 106714586 missense probably benign 0.00
PIT4651001:Olfr705 UTSW 7 106873523 missense probably damaging 1.00
R0501:Olfr705 UTSW 7 106714603 missense probably benign 0.01
R0504:Olfr705 UTSW 7 106714701 splice site probably benign
R0536:Olfr705 UTSW 7 106714321 missense probably damaging 1.00
R0633:Olfr705 UTSW 7 106713977 missense probably benign 0.03
R1225:Olfr705 UTSW 7 106714524 missense probably benign 0.22
R1725:Olfr705 UTSW 7 106714058 missense probably benign
R1864:Olfr705 UTSW 7 106713823 missense possibly damaging 0.87
R2065:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2068:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2081:Olfr705 UTSW 7 106714198 missense probably benign
R4135:Olfr705 UTSW 7 106714003 missense probably damaging 1.00
R5649:Olfr705 UTSW 7 106714166 missense possibly damaging 0.89
R5858:Olfr705 UTSW 7 106873768 missense probably benign 0.01
R6083:Olfr705 UTSW 7 106873582 missense probably damaging 0.98
R7144:Olfr705 UTSW 7 106873868 missense probably damaging 1.00
R7214:Olfr705 UTSW 7 106874267 start gained probably benign
R7366:Olfr705 UTSW 7 106873396 missense probably damaging 1.00
R7445:Olfr705 UTSW 7 106873342 missense possibly damaging 0.55
R8171:Olfr705 UTSW 7 106714618 missense probably benign
R8171:Olfr705 UTSW 7 106714619 missense
R8986:Olfr705 UTSW 7 106873843 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCTGGACTTGCAGAAAGGATAC -3'
(R):5'- AGCCTTGACCAGCAATGGACTG -3'

Sequencing Primer
(F):5'- CATGCTATATCCTAGAGCACTGAGAG -3'
(R):5'- AGCAATGGACTGCTGCTG -3'
Posted On2013-07-30