Incidental Mutation 'R7928:Stra8'
ID611690
Institutional Source Beutler Lab
Gene Symbol Stra8
Ensembl Gene ENSMUSG00000029848
Gene Namestimulated by retinoic acid gene 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location34920163-34939344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34930964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000031876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031876] [ENSMUST00000114997] [ENSMUST00000114999] [ENSMUST00000185102]
Predicted Effect probably benign
Transcript: ENSMUST00000031876
AA Change: D117G

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031876
Gene: ENSMUSG00000029848
AA Change: D117G

DomainStartEndE-ValueType
Blast:HLH 34 83 5e-20 BLAST
coiled coil region 159 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114997
AA Change: D6G

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110649
Gene: ENSMUSG00000029848
AA Change: D6G

DomainStartEndE-ValueType
coiled coil region 48 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114999
AA Change: D117G

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110651
Gene: ENSMUSG00000029848
AA Change: D117G

DomainStartEndE-ValueType
Blast:HLH 34 83 5e-20 BLAST
coiled coil region 159 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185102
AA Change: D96G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139136
Gene: ENSMUSG00000029848
AA Change: D96G

DomainStartEndE-ValueType
low complexity region 122 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid-responsive protein. A homologous protein in mouse has been shown to be involved in the regulation of meiotic initiation in both spermatogenesis and oogenesis, though feature differences between the mouse and human proteins suggest that these homologs are not entirely functionally equivalent. It is thought that this gene may play a role in spermatogenesis in humans. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display impaired meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Stra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Stra8 APN 6 34938063 missense probably benign 0.09
IGL01336:Stra8 APN 6 34933188 missense possibly damaging 0.75
IGL02110:Stra8 APN 6 34930354 splice site probably benign
IGL02572:Stra8 APN 6 34939159 missense probably damaging 1.00
rounded UTSW 6 34933040 nonsense probably null
R1740:Stra8 UTSW 6 34927719 splice site probably benign
R4928:Stra8 UTSW 6 34933156 missense probably benign 0.03
R5412:Stra8 UTSW 6 34930950 start codon destroyed probably null 0.46
R5709:Stra8 UTSW 6 34927762 missense possibly damaging 0.73
R6558:Stra8 UTSW 6 34933040 nonsense probably null
R7081:Stra8 UTSW 6 34934367 critical splice donor site probably null
R7673:Stra8 UTSW 6 34927918 critical splice donor site probably null
R7845:Stra8 UTSW 6 34930964 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATGGCTCTGCATGCTCTAAAG -3'
(R):5'- CGCATCATTTAGGAAGACTACCC -3'

Sequencing Primer
(F):5'- TGGGGTCCCTGAACTAGACAG -3'
(R):5'- CTACCCAAGGCAGGTCATGAG -3'
Posted On2019-12-27