Incidental Mutation 'R7928:Tas2r136'
ID611691
Institutional Source Beutler Lab
Gene Symbol Tas2r136
Ensembl Gene ENSMUSG00000053217
Gene Nametaste receptor, type 2, member 136
SynonymsTas2r36, mt2r52
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location132777179-132778162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132777870 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 98 (Y98F)
Ref Sequence ENSEMBL: ENSMUSP00000070791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065532]
Predicted Effect probably benign
Transcript: ENSMUST00000065532
AA Change: Y98F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070791
Gene: ENSMUSG00000053217
AA Change: Y98F

DomainStartEndE-ValueType
Pfam:TAS2R 23 317 8.4e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAS2R44 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Tas2r136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tas2r136 APN 6 132777198 missense probably damaging 1.00
IGL02414:Tas2r136 APN 6 132777531 missense possibly damaging 0.87
IGL02662:Tas2r136 APN 6 132777708 missense probably damaging 1.00
R0607:Tas2r136 UTSW 6 132777412 missense probably benign 0.09
R0785:Tas2r136 UTSW 6 132777927 missense probably benign
R1727:Tas2r136 UTSW 6 132777790 missense possibly damaging 0.63
R2101:Tas2r136 UTSW 6 132777532 missense probably benign 0.09
R2975:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3080:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3746:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3749:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3750:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R4362:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4411:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4413:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4803:Tas2r136 UTSW 6 132777492 missense probably damaging 1.00
R5283:Tas2r136 UTSW 6 132777411 missense probably damaging 0.99
R5343:Tas2r136 UTSW 6 132778080 missense probably benign 0.00
R5738:Tas2r136 UTSW 6 132777744 missense probably damaging 1.00
R5872:Tas2r136 UTSW 6 132777331 missense possibly damaging 0.46
R6770:Tas2r136 UTSW 6 132777382 missense probably benign 0.03
R7326:Tas2r136 UTSW 6 132777906 missense possibly damaging 0.65
R7845:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7900:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
R7983:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTGTTGTCTCACATATGGTTACC -3'
(R):5'- CTTGGAACCTTTGCCAATGTC -3'

Sequencing Primer
(F):5'- GCACAAAACATGGCAAAAGTAC -3'
(R):5'- GTCTTCATTGTTCTGGTAAACTTCAC -3'
Posted On2019-12-27