Incidental Mutation 'R7928:Wdr62'
ID611692
Institutional Source Beutler Lab
Gene Symbol Wdr62
Ensembl Gene ENSMUSG00000037020
Gene NameWD repeat domain 62
Synonyms2310038K02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30240138-30280419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30265242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000103825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108190] [ENSMUST00000134570] [ENSMUST00000145027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108190
AA Change: V359A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020
AA Change: V359A

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134570
SMART Domains Protein: ENSMUSP00000116139
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
WD40 36 75 2.77e-1 SMART
WD40 78 120 2.3e0 SMART
WD40 124 164 4.18e-2 SMART
WD40 169 211 1.54e0 SMART
WD40 214 256 8.49e-3 SMART
WD40 259 298 3.61e-6 SMART
low complexity region 317 322 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 512 519 N/A INTRINSIC
low complexity region 744 755 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 1006 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145027
AA Change: V359A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020
AA Change: V359A

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice for a hypomorphic allele exhibit reduced brain size due to decreased neural progenitor cells. Cells show spindle instability, spindle assembly checkpoint activation, mitotic arrest and cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Wdr62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Wdr62 APN 7 30243523 missense probably benign 0.00
IGL00428:Wdr62 APN 7 30270752 missense probably damaging 0.99
IGL00579:Wdr62 APN 7 30267895 missense probably damaging 1.00
IGL00709:Wdr62 APN 7 30242061 missense probably benign 0.05
IGL00924:Wdr62 APN 7 30265218 missense probably damaging 0.99
IGL00924:Wdr62 APN 7 30242806 missense probably damaging 1.00
IGL00956:Wdr62 APN 7 30261339 missense probably damaging 0.96
IGL01016:Wdr62 APN 7 30254251 missense probably benign 0.39
IGL01118:Wdr62 APN 7 30242781 missense probably damaging 0.96
IGL01458:Wdr62 APN 7 30241762 missense probably benign 0.08
IGL01977:Wdr62 APN 7 30258101 missense probably damaging 1.00
IGL02065:Wdr62 APN 7 30243469 missense possibly damaging 0.59
IGL02155:Wdr62 APN 7 30262643 missense probably damaging 1.00
IGL02260:Wdr62 APN 7 30270782 missense probably damaging 1.00
IGL02404:Wdr62 APN 7 30267873 missense probably damaging 1.00
IGL02491:Wdr62 APN 7 30242759 missense probably benign 0.19
IGL02556:Wdr62 APN 7 30245284 splice site probably null
IGL02739:Wdr62 APN 7 30242460 nonsense probably null
IGL03387:Wdr62 APN 7 30270774 missense possibly damaging 0.90
I0000:Wdr62 UTSW 7 30245327 missense probably benign 0.03
R0304:Wdr62 UTSW 7 30242874 missense probably benign 0.20
R0371:Wdr62 UTSW 7 30242158 missense possibly damaging 0.56
R0400:Wdr62 UTSW 7 30241462 missense possibly damaging 0.81
R0621:Wdr62 UTSW 7 30254061 missense possibly damaging 0.94
R0634:Wdr62 UTSW 7 30270174 missense probably damaging 0.98
R1758:Wdr62 UTSW 7 30267903 missense probably damaging 1.00
R2205:Wdr62 UTSW 7 30258149 critical splice acceptor site probably null
R2254:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2255:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2566:Wdr62 UTSW 7 30273999 missense probably damaging 1.00
R2851:Wdr62 UTSW 7 30261437 missense possibly damaging 0.70
R3150:Wdr62 UTSW 7 30271670 missense possibly damaging 0.94
R4355:Wdr62 UTSW 7 30242248 missense probably damaging 1.00
R4517:Wdr62 UTSW 7 30270258 missense probably damaging 1.00
R4839:Wdr62 UTSW 7 30241465 missense probably benign 0.00
R4839:Wdr62 UTSW 7 30270686 missense probably damaging 1.00
R5193:Wdr62 UTSW 7 30265167 missense probably damaging 0.99
R5289:Wdr62 UTSW 7 30267875 missense probably damaging 1.00
R5306:Wdr62 UTSW 7 30265263 missense possibly damaging 0.94
R5878:Wdr62 UTSW 7 30241347 missense probably benign
R5942:Wdr62 UTSW 7 30243079 nonsense probably null
R6051:Wdr62 UTSW 7 30261384 missense possibly damaging 0.69
R6237:Wdr62 UTSW 7 30242435 missense probably damaging 1.00
R6727:Wdr62 UTSW 7 30271620 missense probably damaging 1.00
R7158:Wdr62 UTSW 7 30270738 missense possibly damaging 0.77
R7208:Wdr62 UTSW 7 30252336 missense probably damaging 0.97
R7237:Wdr62 UTSW 7 30270444 intron probably null
R7336:Wdr62 UTSW 7 30243917 missense probably damaging 0.98
R7559:Wdr62 UTSW 7 30270773 missense probably damaging 0.98
R7845:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R8002:Wdr62 UTSW 7 30252360 missense probably damaging 1.00
Z1176:Wdr62 UTSW 7 30255928 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAATACCCAAGCTGAGCC -3'
(R):5'- AGGAAAATGAATGTGCTCTCTGAG -3'

Sequencing Primer
(F):5'- GAAGAGGGAAAGCAGTCTCACCTC -3'
(R):5'- TAGGAAGATGGCTGACTG -3'
Posted On2019-12-27