Incidental Mutation 'R7928:Tsks'
ID611693
Institutional Source Beutler Lab
Gene Symbol Tsks
Ensembl Gene ENSMUSG00000059891
Gene Nametestis-specific serine kinase substrate
SynonymsTssks1, Stk22s1, Tsks, clone 4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7928 (G1)
Quality Score212.009
Status Not validated
Chromosome7
Chromosomal Location44943204-44958035 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 44953744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000207719]
Predicted Effect probably null
Transcript: ENSMUST00000080233
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120929
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207719
Predicted Effect probably benign
Transcript: ENSMUST00000208475
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of a small family of testis-specific serine/threonine kinases. This gene may play a role in testicular physiology or spermiogenesis. Its expression is restricted to the testis during the last stages of spermatid maturation. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Tsks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Tsks APN 7 44952558 missense probably damaging 1.00
IGL03006:Tsks APN 7 44950774 unclassified probably benign
IGL03065:Tsks APN 7 44943300 missense probably damaging 1.00
IGL03091:Tsks APN 7 44957895 missense possibly damaging 0.54
R0139:Tsks UTSW 7 44954459 missense probably benign
R0619:Tsks UTSW 7 44950834 missense probably damaging 1.00
R3709:Tsks UTSW 7 44951885 missense possibly damaging 0.62
R4273:Tsks UTSW 7 44957929 missense probably damaging 1.00
R4982:Tsks UTSW 7 44943994 missense possibly damaging 0.69
R5664:Tsks UTSW 7 44953784 missense probably damaging 1.00
R5846:Tsks UTSW 7 44943988 missense probably damaging 1.00
R6193:Tsks UTSW 7 44953839 missense probably damaging 0.96
R6567:Tsks UTSW 7 44953881 missense probably damaging 1.00
R7044:Tsks UTSW 7 44943792 missense probably damaging 0.99
R7255:Tsks UTSW 7 44952688 missense probably benign 0.13
R7845:Tsks UTSW 7 44953744 splice site probably null
R8073:Tsks UTSW 7 44957881 missense probably benign
R8162:Tsks UTSW 7 44953872 missense probably damaging 1.00
R8307:Tsks UTSW 7 44957662 missense
Predicted Primers PCR Primer
(F):5'- AGGTGGTACCGGGCTAAC -3'
(R):5'- AGCTCCTGCAAGCCCCTT -3'

Sequencing Primer
(F):5'- CTGGAACTCACTCTGTAGATCAGG -3'
(R):5'- TGCGGACTGTGCCTGTTCC -3'
Posted On2019-12-27