Incidental Mutation 'R0686:Cyp2r1'
ID61170
Institutional Source Beutler Lab
Gene Symbol Cyp2r1
Ensembl Gene ENSMUSG00000030670
Gene Namecytochrome P450, family 2, subfamily r, polypeptide 1
Synonyms
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0686 (G1)
Quality Score128
Status Not validated
Chromosome7
Chromosomal Location114549682-114562972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 114552011 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 358 (M358L)
Ref Sequence ENSEMBL: ENSMUSP00000032908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032908] [ENSMUST00000119712] [ENSMUST00000128587] [ENSMUST00000138712] [ENSMUST00000147428] [ENSMUST00000211506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032908
AA Change: M358L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032908
Gene: ENSMUSG00000030670
AA Change: M358L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 40 498 7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119712
AA Change: M147L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112818
Gene: ENSMUSG00000030670
AA Change: M147L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 40 124 2.3e-15 PFAM
Pfam:p450 115 287 1.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128587
SMART Domains Protein: ENSMUSP00000121924
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
Pfam:p450 1 260 5.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133484
Predicted Effect probably benign
Transcript: ENSMUST00000138712
SMART Domains Protein: ENSMUSP00000123556
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147428
SMART Domains Protein: ENSMUSP00000119605
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000211506
AA Change: M149L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more than a 50% reduction in serum 25-hydroxyvitamin D3 levels but remain healthy and show normal serum 1alpha,25-dihydroxyvitamin D3 levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Cyp2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Cyp2r1 APN 7 114551826 missense probably benign 0.00
IGL01515:Cyp2r1 APN 7 114552712 splice site probably benign
R0178:Cyp2r1 UTSW 7 114550408 missense probably damaging 1.00
R0518:Cyp2r1 UTSW 7 114552900 missense probably benign 0.01
R1772:Cyp2r1 UTSW 7 114553216 missense probably damaging 0.99
R2044:Cyp2r1 UTSW 7 114550405 missense probably damaging 0.98
R3785:Cyp2r1 UTSW 7 114554696 missense possibly damaging 0.69
R6248:Cyp2r1 UTSW 7 114562731 critical splice donor site probably null
R6995:Cyp2r1 UTSW 7 114553081 missense probably damaging 1.00
R7048:Cyp2r1 UTSW 7 114552736 missense probably damaging 1.00
R7063:Cyp2r1 UTSW 7 114552949 missense probably damaging 1.00
R7538:Cyp2r1 UTSW 7 114562767 missense probably damaging 1.00
R7549:Cyp2r1 UTSW 7 114554644 missense possibly damaging 0.58
R7680:Cyp2r1 UTSW 7 114552819 missense probably damaging 1.00
R7882:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R8054:Cyp2r1 UTSW 7 114552084 critical splice acceptor site probably null
R8116:Cyp2r1 UTSW 7 114550355 missense probably benign
R8326:Cyp2r1 UTSW 7 114553170 missense probably damaging 1.00
Z1088:Cyp2r1 UTSW 7 114551974 missense probably damaging 1.00
Z1177:Cyp2r1 UTSW 7 114553339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTCCAGAAATCGCTCAGG -3'
(R):5'- TGAGTATGTGGAAGCTGCAAAGCTG -3'

Sequencing Primer
(F):5'- TCGCTCAGGATAGAACATGTC -3'
(R):5'- AACACTACTCTGATTCTAGGCTG -3'
Posted On2013-07-30