Incidental Mutation 'R7928:Fbxw14'
ID611701
Institutional Source Beutler Lab
Gene Symbol Fbxw14
Ensembl Gene ENSMUSG00000105589
Gene NameF-box and WD-40 domain protein 14
SynonymsE330009N23Rik, Fbxo12, Fbx12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109270790-109287676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109287603 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 13 (I13F)
Ref Sequence ENSEMBL: ENSMUSP00000143404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112041] [ENSMUST00000198844] [ENSMUST00000198928]
Predicted Effect probably damaging
Transcript: ENSMUST00000112041
AA Change: I13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107672
Gene: ENSMUSG00000105589
AA Change: I13F

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198844
AA Change: I13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143404
Gene: ENSMUSG00000105589
AA Change: I13F

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 114 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198928
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Fbxw14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Fbxw14 APN 9 109278791 missense probably damaging 1.00
IGL01351:Fbxw14 APN 9 109274572 missense possibly damaging 0.47
IGL01654:Fbxw14 APN 9 109286580 splice site probably benign
K3955:Fbxw14 UTSW 9 109276245 missense possibly damaging 0.87
R0064:Fbxw14 UTSW 9 109287592 nonsense probably null
R0133:Fbxw14 UTSW 9 109274579 missense probably benign 0.02
R0975:Fbxw14 UTSW 9 109271239 missense probably benign 0.00
R1124:Fbxw14 UTSW 9 109276168 missense possibly damaging 0.48
R1782:Fbxw14 UTSW 9 109278691 missense possibly damaging 0.94
R2118:Fbxw14 UTSW 9 109274624 splice site probably benign
R3881:Fbxw14 UTSW 9 109271194 missense possibly damaging 0.95
R4641:Fbxw14 UTSW 9 109278682 critical splice donor site probably null
R4915:Fbxw14 UTSW 9 109274524 missense possibly damaging 0.82
R4952:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
R6137:Fbxw14 UTSW 9 109276222 missense probably damaging 1.00
R6187:Fbxw14 UTSW 9 109276264 missense probably damaging 1.00
R6584:Fbxw14 UTSW 9 109286543 missense possibly damaging 0.85
R7130:Fbxw14 UTSW 9 109271282 missense probably benign 0.02
R7845:Fbxw14 UTSW 9 109287603 missense probably damaging 1.00
R8049:Fbxw14 UTSW 9 109276143 missense probably damaging 0.98
X0067:Fbxw14 UTSW 9 109276201 missense probably benign 0.01
Z1177:Fbxw14 UTSW 9 109276246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGAGCTTAGTAGACAGGTCTG -3'
(R):5'- GCTGAGAGTCTACACAGCTG -3'

Sequencing Primer
(F):5'- AGCTTAGTAGACAGGTCTGAATAAG -3'
(R):5'- GCTGCAGCTTGCTCCAAC -3'
Posted On2019-12-27