Incidental Mutation 'R7928:Sec14l3'
ID611706
Institutional Source Beutler Lab
Gene Symbol Sec14l3
Ensembl Gene ENSMUSG00000054986
Gene NameSEC14-like lipid binding 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4064841-4077736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4067972 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 84 (M84K)
Ref Sequence ENSEMBL: ENSMUSP00000065084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068322]
Predicted Effect probably benign
Transcript: ENSMUST00000068322
AA Change: M84K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065084
Gene: ENSMUSG00000054986
AA Change: M84K

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 2.71e-7 SMART
SEC14 76 247 1.18e-66 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Sec14l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Sec14l3 APN 11 4076238 splice site probably benign
IGL01382:Sec14l3 APN 11 4068104 missense probably damaging 0.98
IGL02304:Sec14l3 APN 11 4074768 missense probably damaging 1.00
IGL02565:Sec14l3 APN 11 4076237 splice site probably benign
IGL02836:Sec14l3 APN 11 4070084 missense probably benign 0.02
R0183:Sec14l3 UTSW 11 4075547 missense probably benign 0.03
R0597:Sec14l3 UTSW 11 4074814 missense probably damaging 1.00
R1425:Sec14l3 UTSW 11 4066487 missense probably damaging 1.00
R1834:Sec14l3 UTSW 11 4066510 splice site probably benign
R2090:Sec14l3 UTSW 11 4075481 missense probably benign 0.00
R3839:Sec14l3 UTSW 11 4071544 intron probably null
R4424:Sec14l3 UTSW 11 4066210 missense probably damaging 1.00
R4948:Sec14l3 UTSW 11 4068101 missense possibly damaging 0.75
R5124:Sec14l3 UTSW 11 4075209 missense possibly damaging 0.67
R5588:Sec14l3 UTSW 11 4066138 missense probably damaging 1.00
R5635:Sec14l3 UTSW 11 4071484 missense probably damaging 1.00
R6185:Sec14l3 UTSW 11 4075244 missense probably damaging 1.00
R6192:Sec14l3 UTSW 11 4075566 splice site probably null
R6699:Sec14l3 UTSW 11 4075193 missense possibly damaging 0.78
R7002:Sec14l3 UTSW 11 4075263 missense possibly damaging 0.87
R7351:Sec14l3 UTSW 11 4074785 missense probably benign 0.00
R7357:Sec14l3 UTSW 11 4070127 missense probably benign 0.03
R7845:Sec14l3 UTSW 11 4067972 missense probably benign 0.38
R7890:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
R7973:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
R8108:Sec14l3 UTSW 11 4066198 missense probably damaging 1.00
RF011:Sec14l3 UTSW 11 4067963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATATGCCCTGAAGCCTGAAGC -3'
(R):5'- TCTGTCTGCAGGTCACACTC -3'

Sequencing Primer
(F):5'- TGTATTCACAGCTGTAAACAAGGCC -3'
(R):5'- TCATGCAGGATACGTTCACAGTC -3'
Posted On2019-12-27