Incidental Mutation 'R7928:Bcl2l2'
ID611713
Institutional Source Beutler Lab
Gene Symbol Bcl2l2
Ensembl Gene ENSMUSG00000089682
Gene NameBCL2-like 2
SynonymsGtrosa41, bclw, Bcl-w, Gtrgal2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54883377-54888234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54884851 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 157 (Y157C)
Ref Sequence ENSEMBL: ENSMUSP00000116385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022806] [ENSMUST00000133397] [ENSMUST00000134077] [ENSMUST00000172844] [ENSMUST00000227108]
Predicted Effect probably benign
Transcript: ENSMUST00000022806
SMART Domains Protein: ENSMUSP00000022806
Gene: ENSMUSG00000089682

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 172 188 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133397
AA Change: Y157C
SMART Domains Protein: ENSMUSP00000116385
Gene: ENSMUSG00000089682
AA Change: Y157C

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134077
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172844
SMART Domains Protein: ENSMUSP00000133286
Gene: ENSMUSG00000089682

DomainStartEndE-ValueType
Pfam:Bcl-2 1 30 3.9e-7 PFAM
Blast:BCL 31 53 1e-7 BLAST
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227108
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants are male sterile with progressive loss of germ cells, Sertoli cells and Leydig cells beginning at puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Bcl2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03126:Bcl2l2 APN 14 54884767 missense probably damaging 1.00
R2656:Bcl2l2 UTSW 14 54885432 missense probably benign 0.02
R4042:Bcl2l2 UTSW 14 54884634 missense possibly damaging 0.82
R5278:Bcl2l2 UTSW 14 54884794 missense probably damaging 0.98
R6129:Bcl2l2 UTSW 14 54884745 missense possibly damaging 0.86
R6234:Bcl2l2 UTSW 14 54884788 missense probably benign 0.00
R7205:Bcl2l2 UTSW 14 54884601 missense probably benign
R7747:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7748:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7779:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7845:Bcl2l2 UTSW 14 54884851 missense unknown
R7855:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7938:Bcl2l2 UTSW 14 54884379 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCGACGAACTTTTCCAAGGG -3'
(R):5'- TTCAGTCTTCTGCTTGGGAC -3'

Sequencing Primer
(F):5'- AACTTTTCCAAGGGGGCCC -3'
(R):5'- TTGGGACCGTGAAGCCCATC -3'
Posted On2019-12-27