Incidental Mutation 'R7928:Xrcc6'
ID611715
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7928 (G1)
Quality Score102.008
Status Not validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 82016477 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023110] [ENSMUST00000069530] [ENSMUST00000089187] [ENSMUST00000100399] [ENSMUST00000135988] [ENSMUST00000146628] [ENSMUST00000152227] [ENSMUST00000164779] [ENSMUST00000165777] [ENSMUST00000168581]
Predicted Effect probably benign
Transcript: ENSMUST00000023110
SMART Domains Protein: ENSMUSP00000023110
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
PDB:2WP7|A 1 30 2e-14 PDB
Blast:DUF862 7 56 3e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000069530
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089187
Predicted Effect probably benign
Transcript: ENSMUST00000100399
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135988
SMART Domains Protein: ENSMUSP00000117613
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
DUF862 7 106 5.05e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146628
SMART Domains Protein: ENSMUSP00000114888
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
PDB:3EBQ|A 1 84 9e-22 PDB
Blast:DUF862 7 84 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152227
SMART Domains Protein: ENSMUSP00000121504
Gene: ENSMUSG00000022472

DomainStartEndE-ValueType
DUF862 7 150 1.68e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164779
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165777
SMART Domains Protein: ENSMUSP00000131212
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 106 7.6e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168581
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3870:Xrcc6 UTSW 15 82025684 missense probably benign 0.16
R3906:Xrcc6 UTSW 15 82029571 missense probably benign 0.01
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 intron probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6904:Xrcc6 UTSW 15 82029122 missense probably benign 0.19
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
R7213:Xrcc6 UTSW 15 82016826 intron probably benign
R7642:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R7845:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R8105:Xrcc6 UTSW 15 82031151 missense probably damaging 1.00
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Z1176:Xrcc6 UTSW 15 82029213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGTTTAGGGAACAGGGG -3'
(R):5'- GTGCTCTGGCTGAAACATTCG -3'

Sequencing Primer
(F):5'- TTTAGGGAACAGGGGGTGGAAG -3'
(R):5'- ACCTTCAGCTAGAGATTGGC -3'
Posted On2019-12-27