Incidental Mutation 'R7928:Ccdc14'
ID611717
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Namecoiled-coil domain containing 14
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location34690616-34725202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34715364 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 495 (L495P)
Ref Sequence ENSEMBL: ENSMUSP00000023532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
Predicted Effect probably damaging
Transcript: ENSMUST00000023532
AA Change: L495P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: L495P

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231609
AA Change: L447P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2337:Ccdc14 UTSW 16 34705018 missense probably benign 0.04
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4645:Ccdc14 UTSW 16 34721740 missense probably damaging 1.00
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5319:Ccdc14 UTSW 16 34723172 missense probably damaging 0.99
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R5945:Ccdc14 UTSW 16 34723588 missense probably damaging 1.00
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6662:Ccdc14 UTSW 16 34690794 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
R7845:Ccdc14 UTSW 16 34715364 missense probably damaging 1.00
R7889:Ccdc14 UTSW 16 34723836 missense probably damaging 1.00
R7903:Ccdc14 UTSW 16 34704910 missense probably damaging 0.99
R7972:Ccdc14 UTSW 16 34723836 missense probably damaging 1.00
R7986:Ccdc14 UTSW 16 34704910 missense probably damaging 0.99
R8093:Ccdc14 UTSW 16 34709652 missense probably damaging 1.00
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Z1176:Ccdc14 UTSW 16 34706498 missense probably damaging 1.00
Z1177:Ccdc14 UTSW 16 34723670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCCTGTTAACAGTTGG -3'
(R):5'- CCCGACTATTTAAGATATCTGCACAC -3'

Sequencing Primer
(F):5'- CCCCTGTTAACAGTTGGGGTTTG -3'
(R):5'- TAGGGGCTTACTACAGACAGTTC -3'
Posted On2019-12-27