Incidental Mutation 'R7928:Eif2ak2'
ID611719
Institutional Source Beutler Lab
Gene Symbol Eif2ak2
Ensembl Gene ENSMUSG00000024079
Gene Nameeukaryotic translation initiation factor 2-alpha kinase 2
SynonymsdsRNA-activated kinase, eIF-2 alpha, eIF-2 alpha, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Pkr, Prkr, Tik
Accession Numbers

Genbank: NM_011163; MGI: 1353449

Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R7928 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78852564-78882573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78863898 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 359 (Q359K)
Ref Sequence ENSEMBL: ENSMUSP00000024884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024884]
PDB Structure
Solution structure of the second DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Solution structure of the first DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000024884
AA Change: Q359K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024884
Gene: ENSMUSG00000024079
AA Change: Q359K

DomainStartEndE-ValueType
DSRM 9 75 2.34e-20 SMART
DSRM 96 161 7.66e-16 SMART
low complexity region 169 196 N/A INTRINSIC
Pfam:Pkinase 242 500 4.6e-56 PFAM
Pfam:Pkinase_Tyr 242 500 8e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display altered susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(2) Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Eif2ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Eif2ak2 APN 17 78869483 missense probably benign 0.00
IGL01017:Eif2ak2 APN 17 78863858 missense probably damaging 1.00
IGL01068:Eif2ak2 APN 17 78865371 missense probably damaging 1.00
3-1:Eif2ak2 UTSW 17 78869498 missense probably benign 0.00
R0038:Eif2ak2 UTSW 17 78863955 missense probably benign
R0801:Eif2ak2 UTSW 17 78866349 nonsense probably null
R1702:Eif2ak2 UTSW 17 78856634 missense probably damaging 1.00
R2020:Eif2ak2 UTSW 17 78863963 missense possibly damaging 0.87
R2159:Eif2ak2 UTSW 17 78874018 missense possibly damaging 0.77
R3405:Eif2ak2 UTSW 17 78858639 splice site probably benign
R3406:Eif2ak2 UTSW 17 78858639 splice site probably benign
R4355:Eif2ak2 UTSW 17 78858534 missense probably benign 0.08
R5135:Eif2ak2 UTSW 17 78866345 missense probably damaging 0.96
R5145:Eif2ak2 UTSW 17 78876204 missense possibly damaging 0.60
R5336:Eif2ak2 UTSW 17 78874043 missense probably benign 0.00
R6195:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6233:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6417:Eif2ak2 UTSW 17 78856619 missense probably damaging 1.00
R6737:Eif2ak2 UTSW 17 78863948 missense probably benign 0.00
R7108:Eif2ak2 UTSW 17 78858536 nonsense probably null
R7238:Eif2ak2 UTSW 17 78866331 missense probably benign 0.01
R7830:Eif2ak2 UTSW 17 78866403 missense probably damaging 1.00
R7843:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7845:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
R7926:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R8003:Eif2ak2 UTSW 17 78876223 missense probably damaging 0.99
R8143:Eif2ak2 UTSW 17 78858532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTAGGTCCAGCAGATTAGAGAGATG -3'
(R):5'- ATCGAAGCTCTGGATGCTTGG -3'

Sequencing Primer
(F):5'- TGTAATTTTATCGTGACTAACTGCC -3'
(R):5'- CTCTGGATGCTTGGGAAATTATGAC -3'
Posted On2019-12-27