Incidental Mutation 'R0686:Olfr970'
ID61174
Institutional Source Beutler Lab
Gene Symbol Olfr970
Ensembl Gene ENSMUSG00000095774
Gene Nameolfactory receptor 970
SynonymsMOR171-16, GA_x6K02T2PVTD-33517322-33518257
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R0686 (G1)
Quality Score91
Status Not validated
Chromosome9
Chromosomal Location39808860-39820997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39819668 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 10 (T10P)
Ref Sequence ENSEMBL: ENSMUSP00000150325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071132] [ENSMUST00000213975] [ENSMUST00000215922]
Predicted Effect probably damaging
Transcript: ENSMUST00000071132
AA Change: T10P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071132
Gene: ENSMUSG00000095774
AA Change: T10P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-53 PFAM
Pfam:7tm_1 41 290 1.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213975
AA Change: T10P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215265
Predicted Effect probably damaging
Transcript: ENSMUST00000215922
AA Change: T10P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Olfr970
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr970 APN 9 39820002 missense probably damaging 1.00
IGL02674:Olfr970 APN 9 39819638 unclassified probably null
R0659:Olfr970 UTSW 9 39819816 missense possibly damaging 0.78
R1952:Olfr970 UTSW 9 39820067 missense probably benign 0.09
R2068:Olfr970 UTSW 9 39820550 missense probably benign 0.00
R4472:Olfr970 UTSW 9 39820574 makesense probably null
R4798:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R5035:Olfr970 UTSW 9 39820094 missense possibly damaging 0.82
R5339:Olfr970 UTSW 9 39819933 missense probably damaging 0.97
R6751:Olfr970 UTSW 9 39819897 missense probably benign 0.13
R7211:Olfr970 UTSW 9 39819858 missense possibly damaging 0.76
R7471:Olfr970 UTSW 9 39820127 missense probably benign 0.00
R7609:Olfr970 UTSW 9 39820287 missense probably benign
R7638:Olfr970 UTSW 9 39819893 missense probably damaging 1.00
R7890:Olfr970 UTSW 9 39820014 missense probably damaging 0.99
R7973:Olfr970 UTSW 9 39820014 missense probably damaging 0.99
Z1176:Olfr970 UTSW 9 39820355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTCCTTAGCAGACTCCAC -3'
(R):5'- AGGGGTTACAGATTGCAACATAGCG -3'

Sequencing Primer
(F):5'- GTGTTAAGCAGTCCAATGCTTC -3'
(R):5'- GCTAACATGTGACACTCTGC -3'
Posted On2013-07-30