Incidental Mutation 'R0686:Bsx'
ID61175
Institutional Source Beutler Lab
Gene Symbol Bsx
Ensembl Gene ENSMUSG00000054360
Gene Namebrain specific homeobox
SynonymsBsx1a, Bsx1b
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0686 (G1)
Quality Score87
Status Not validated
Chromosome9
Chromosomal Location40874127-40880057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40876437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 136 (S136A)
Ref Sequence ENSEMBL: ENSMUSP00000068057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067375]
Predicted Effect probably damaging
Transcript: ENSMUST00000067375
AA Change: S136A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068057
Gene: ENSMUSG00000054360
AA Change: S136A

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
HOX 110 172 2.64e-26 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for mutations in Bsx display increased fat mass, decreased food intake after fasting, decreased body temperature, and reduced locomotor activity, but body weight and glucose homoeostasis are similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Bsx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Bsx APN 9 40874221 missense probably benign 0.00
IGL02510:Bsx APN 9 40874221 missense possibly damaging 0.49
IGL03295:Bsx APN 9 40874447 splice site probably benign
R0507:Bsx UTSW 9 40876500 splice site probably benign
R3120:Bsx UTSW 9 40877612 missense possibly damaging 0.95
R4155:Bsx UTSW 9 40876336 missense probably benign 0.04
R5504:Bsx UTSW 9 40874164 start gained probably benign
R6328:Bsx UTSW 9 40874223 missense probably damaging 1.00
X0027:Bsx UTSW 9 40877773 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTCCGGCTGTTATTGAGAGATG -3'
(R):5'- GCCGAATCAAAGTGATTTTCCCTCTCC -3'

Sequencing Primer
(F):5'- AGGATGCTTCCTCCGAATG -3'
(R):5'- CTGTCGGATCTTGGAAACATGC -3'
Posted On2013-07-30