Incidental Mutation 'R7929:Sptb'
ID611770
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R7929 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 76608526 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1480 (K1480*)
Ref Sequence ENSEMBL: ENSMUSP00000021458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably null
Transcript: ENSMUST00000021458
AA Change: K1480*
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: K1480*

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166101
AA Change: K1480*
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: K1480*

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Extl3 A T 14: 65,075,732 M667K probably damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Fgd4 T G 16: 16,422,726 Q713P probably damaging Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Kdm5b G A 1: 134,617,840 R913H probably damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Napepld C T 5: 21,675,723 E225K probably benign Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Nova1 A T 12: 46,720,867 probably null Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Phf12 T A 11: 78,009,394 probably null Het
Prss57 G A 10: 79,787,379 A78V probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7733:Sptb UTSW 12 76597921 intron probably null
R7846:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGACTTGTAAGCTCCCATTCAC -3'
(R):5'- AGTCCTGACACTGTTTCTCACG -3'

Sequencing Primer
(F):5'- TTGTAAGCTCCCATTCACAAAGAATC -3'
(R):5'- GTTTCTCACGTCCCAGCGAG -3'
Posted On2019-12-27