Incidental Mutation 'R0686:Paqr5'
ID61178
Institutional Source Beutler Lab
Gene Symbol Paqr5
Ensembl Gene ENSMUSG00000032278
Gene Nameprogestin and adipoQ receptor family member V
Synonyms0610010I15Rik, mPRg
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0686 (G1)
Quality Score109
Status Not validated
Chromosome9
Chromosomal Location61953481-62026856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 61972794 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 59 (T59P)
Ref Sequence ENSEMBL: ENSMUSP00000109623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034817] [ENSMUST00000113990]
Predicted Effect probably benign
Transcript: ENSMUST00000034817
AA Change: T73P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034817
Gene: ENSMUSG00000032278
AA Change: T73P

DomainStartEndE-ValueType
Pfam:HlyIII 43 269 1.6e-59 PFAM
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113990
AA Change: T59P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109623
Gene: ENSMUSG00000032278
AA Change: T59P

DomainStartEndE-ValueType
Pfam:HlyIII 29 255 6.4e-51 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135050
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Paqr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02893:Paqr5 APN 9 61968868 missense probably benign 0.00
IGL03190:Paqr5 APN 9 61972802 missense probably damaging 0.97
PIT4480001:Paqr5 UTSW 9 61956156 missense probably benign 0.09
R0528:Paqr5 UTSW 9 61956245 missense probably damaging 1.00
R0688:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R5663:Paqr5 UTSW 9 61968862 missense probably benign 0.03
R6726:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6728:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6795:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6796:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6809:Paqr5 UTSW 9 61968782 missense probably null 1.00
R6857:Paqr5 UTSW 9 61976088 missense probably damaging 1.00
R6967:Paqr5 UTSW 9 61972831 nonsense probably null
R7456:Paqr5 UTSW 9 61972790 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CGTACCCAGGCTGAAGAGATTGAC -3'
(R):5'- TGGCTAGAGGCCATGCAAATATGAC -3'

Sequencing Primer
(F):5'- GAGATTGACGGCACCATAGTCC -3'
(R):5'- tgggaaagatgctgttggg -3'
Posted On2013-07-30