Incidental Mutation 'R0686:Ckb'
ID61181
Institutional Source Beutler Lab
Gene Symbol Ckb
Ensembl Gene ENSMUSG00000001270
Gene Namecreatine kinase, brain
SynonymsB-CK, Ck-3
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0686 (G1)
Quality Score95
Status Not validated
Chromosome12
Chromosomal Location111669361-111672338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111670193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000001304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001304]
Predicted Effect probably benign
Transcript: ENSMUST00000001304
AA Change: V249A

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001304
Gene: ENSMUSG00000001270
AA Change: V249A

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 1.9e-36 PFAM
Pfam:ATP-gua_Ptrans 120 367 1.9e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223099
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have abnormal hippocampal morphology with enlarged mossy fiber field size and display resistance to pharmacologically induced seizures, reduced habituation and spatial learning impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Ckb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Ckb APN 12 111669981 missense possibly damaging 0.94
R0179:Ckb UTSW 12 111670176 missense probably benign 0.00
R1065:Ckb UTSW 12 111671247 missense probably benign 0.07
R1311:Ckb UTSW 12 111669645 small deletion probably benign
R1481:Ckb UTSW 12 111671262 missense probably benign 0.05
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1891:Ckb UTSW 12 111669645 small deletion probably benign
R2345:Ckb UTSW 12 111671804 missense probably damaging 1.00
R4936:Ckb UTSW 12 111671230 missense probably benign 0.14
R5934:Ckb UTSW 12 111670229 missense probably damaging 1.00
R6149:Ckb UTSW 12 111671814 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCAGGTGAGGATTCCACATGAAC -3'
(R):5'- CATTCCAGCACTTTGTTGAGGAAGC -3'

Sequencing Primer
(F):5'- GTGAGGATTCCACATGAACTCATAG -3'
(R):5'- TGAGGTCACCCACCTATAGTG -3'
Posted On2013-07-30