Incidental Mutation 'R7930:Vmn2r17'
ID611810
Institutional Source Beutler Lab
Gene Symbol Vmn2r17
Ensembl Gene ENSMUSG00000091879
Gene Namevomeronasal 2, receptor 17
SynonymsEG384221
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7930 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109420013-109453387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109420197 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000131450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171841]
Predicted Effect probably damaging
Transcript: ENSMUST00000171841
AA Change: Y62C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: Y62C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 465 7e-26 PFAM
Pfam:NCD3G 508 562 3.5e-18 PFAM
Pfam:7tm_3 593 830 4.8e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Vmn2r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Vmn2r17 APN 5 109427992 missense probably benign 0.15
IGL01457:Vmn2r17 APN 5 109453032 missense probably benign 0.00
IGL01527:Vmn2r17 APN 5 109453140 missense probably damaging 1.00
IGL01693:Vmn2r17 APN 5 109452518 missense probably damaging 1.00
IGL01738:Vmn2r17 APN 5 109429498 missense probably damaging 1.00
IGL01767:Vmn2r17 APN 5 109420037 missense probably benign 0.01
IGL01932:Vmn2r17 APN 5 109427050 missense probably benign 0.00
IGL01970:Vmn2r17 APN 5 109427947 missense probably damaging 0.97
IGL02009:Vmn2r17 APN 5 109452848 missense possibly damaging 0.67
IGL02365:Vmn2r17 APN 5 109453309 missense probably damaging 1.00
IGL02385:Vmn2r17 APN 5 109434381 missense probably damaging 1.00
IGL02457:Vmn2r17 APN 5 109453146 missense probably damaging 1.00
IGL02646:Vmn2r17 APN 5 109453080 missense probably damaging 1.00
IGL02741:Vmn2r17 APN 5 109420211 missense probably benign
IGL03213:Vmn2r17 APN 5 109434390 critical splice donor site probably null
IGL03216:Vmn2r17 APN 5 109452890 missense probably damaging 1.00
IGL03342:Vmn2r17 APN 5 109427916 missense probably damaging 1.00
IGL03408:Vmn2r17 APN 5 109429372 splice site probably benign
R0349:Vmn2r17 UTSW 5 109428336 missense probably damaging 1.00
R0418:Vmn2r17 UTSW 5 109452881 missense probably damaging 1.00
R0800:Vmn2r17 UTSW 5 109427326 splice site probably benign
R0836:Vmn2r17 UTSW 5 109427956 missense possibly damaging 0.89
R1715:Vmn2r17 UTSW 5 109428244 missense probably benign 0.00
R1738:Vmn2r17 UTSW 5 109428511 missense probably benign 0.10
R1801:Vmn2r17 UTSW 5 109428478 missense probably damaging 1.00
R2054:Vmn2r17 UTSW 5 109452486 missense probably damaging 0.98
R2060:Vmn2r17 UTSW 5 109427209 missense probably benign 0.00
R2192:Vmn2r17 UTSW 5 109434278 missense possibly damaging 0.81
R2315:Vmn2r17 UTSW 5 109428031 missense probably damaging 1.00
R2374:Vmn2r17 UTSW 5 109427238 missense probably benign
R3612:Vmn2r17 UTSW 5 109429597 missense probably benign 0.00
R3832:Vmn2r17 UTSW 5 109428396 missense probably damaging 1.00
R4273:Vmn2r17 UTSW 5 109452966 missense probably benign 0.44
R4494:Vmn2r17 UTSW 5 109428469 missense probably damaging 1.00
R4597:Vmn2r17 UTSW 5 109429562 missense probably benign 0.01
R4675:Vmn2r17 UTSW 5 109427183 missense probably benign 0.00
R4701:Vmn2r17 UTSW 5 109427983 missense probably damaging 0.99
R4754:Vmn2r17 UTSW 5 109452849 missense probably damaging 0.99
R4841:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4842:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4865:Vmn2r17 UTSW 5 109427119 missense probably damaging 1.00
R4902:Vmn2r17 UTSW 5 109453354 missense probably benign 0.14
R4989:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R5101:Vmn2r17 UTSW 5 109428351 missense probably damaging 0.99
R5109:Vmn2r17 UTSW 5 109429476 missense probably benign 0.06
R5123:Vmn2r17 UTSW 5 109427908 missense possibly damaging 0.90
R5474:Vmn2r17 UTSW 5 109434284 missense probably damaging 1.00
R5485:Vmn2r17 UTSW 5 109420106 missense probably benign 0.06
R5611:Vmn2r17 UTSW 5 109428164 missense probably damaging 0.97
R5652:Vmn2r17 UTSW 5 109429564 missense probably benign 0.10
R5717:Vmn2r17 UTSW 5 109427274 missense possibly damaging 0.94
R5735:Vmn2r17 UTSW 5 109452850 missense possibly damaging 0.67
R5766:Vmn2r17 UTSW 5 109427273 missense possibly damaging 0.46
R6645:Vmn2r17 UTSW 5 109428381 missense probably damaging 1.00
R6786:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R6821:Vmn2r17 UTSW 5 109429465 missense probably damaging 1.00
R6979:Vmn2r17 UTSW 5 109428399 missense possibly damaging 0.46
R6984:Vmn2r17 UTSW 5 109452667 missense probably benign 0.10
R7269:Vmn2r17 UTSW 5 109428471 missense possibly damaging 0.88
R7509:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R7736:Vmn2r17 UTSW 5 109452891 missense probably benign 0.05
R7789:Vmn2r17 UTSW 5 109452965 missense possibly damaging 0.77
R7814:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R7847:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7863:Vmn2r17 UTSW 5 109420169 missense probably benign
R7893:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
R7946:Vmn2r17 UTSW 5 109420169 missense probably benign
R7976:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GACATGAAGAAGCTGTGTGTTTTC -3'
(R):5'- GGGAATTGGAGTCCACTGTACTG -3'

Sequencing Primer
(F):5'- CACTATTTCCTTCTTGCTCATGAC -3'
(R):5'- TTGGAGTCCACTGTACTGAAACC -3'
Posted On2019-12-27