Incidental Mutation 'R0686:Simc1'
ID61183
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene NameSUMO-interacting motifs containing 1
Synonyms4732471D19Rik
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0686 (G1)
Quality Score90
Status Not validated
Chromosome13
Chromosomal Location54503779-54551290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54525190 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 450 (S450R)
Ref Sequence ENSEMBL: ENSMUSP00000113676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121401
AA Change: S450R

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: S450R

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123852
Predicted Effect probably benign
Transcript: ENSMUST00000138869
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150011
Predicted Effect probably benign
Transcript: ENSMUST00000159721
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54525176 missense probably benign 0.27
IGL00813:Simc1 APN 13 54546986 missense probably damaging 0.98
IGL01326:Simc1 APN 13 54524660 missense probably benign 0.00
IGL01587:Simc1 APN 13 54539704 missense probably damaging 1.00
IGL02887:Simc1 APN 13 54525258 missense probably benign 0.04
IGL02977:Simc1 APN 13 54526307 missense probably benign 0.15
IGL03051:Simc1 APN 13 54526223 missense probably benign 0.15
IGL03065:Simc1 APN 13 54537212 missense probably damaging 1.00
IGL03244:Simc1 APN 13 54550629 missense probably benign 0.06
R0158:Simc1 UTSW 13 54524717 missense probably benign 0.00
R0218:Simc1 UTSW 13 54526604 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0362:Simc1 UTSW 13 54528467 missense probably damaging 1.00
R0464:Simc1 UTSW 13 54537100 nonsense probably null
R0556:Simc1 UTSW 13 54525347 missense probably benign 0.16
R0616:Simc1 UTSW 13 54547032 missense probably benign 0.03
R0715:Simc1 UTSW 13 54525655 missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54526574 missense probably damaging 1.00
R1335:Simc1 UTSW 13 54525265 intron probably benign
R1344:Simc1 UTSW 13 54550479 missense probably damaging 1.00
R1345:Simc1 UTSW 13 54525247 intron probably benign
R1585:Simc1 UTSW 13 54525258 missense probably benign 0.04
R1633:Simc1 UTSW 13 54525231 missense probably benign 0.05
R1725:Simc1 UTSW 13 54526406 missense probably damaging 0.99
R1826:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1827:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1893:Simc1 UTSW 13 54539715 missense probably damaging 0.99
R2012:Simc1 UTSW 13 54503888 missense probably benign 0.05
R2088:Simc1 UTSW 13 54541534 missense probably damaging 1.00
R2901:Simc1 UTSW 13 54541518 splice site probably null
R2974:Simc1 UTSW 13 54550461 missense probably damaging 1.00
R4238:Simc1 UTSW 13 54526260 nonsense probably null
R4870:Simc1 UTSW 13 54539763 missense probably null 0.73
R4959:Simc1 UTSW 13 54525318 missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54526362 missense probably benign 0.15
R5217:Simc1 UTSW 13 54539896 unclassified probably benign
R5319:Simc1 UTSW 13 54524982 missense probably benign 0.00
R5635:Simc1 UTSW 13 54525404 missense probably benign 0.00
R5660:Simc1 UTSW 13 54547089 missense probably benign 0.01
R5900:Simc1 UTSW 13 54547024 missense probably damaging 1.00
R5963:Simc1 UTSW 13 54525819 missense possibly damaging 0.84
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6089:Simc1 UTSW 13 54528490 missense probably benign 0.30
R6271:Simc1 UTSW 13 54539724 missense probably damaging 1.00
R6322:Simc1 UTSW 13 54550569 missense probably damaging 1.00
R6364:Simc1 UTSW 13 54524600 nonsense probably null
R6434:Simc1 UTSW 13 54526664 missense probably benign 0.22
R6627:Simc1 UTSW 13 54547074 missense probably damaging 1.00
R6758:Simc1 UTSW 13 54525548 missense possibly damaging 0.57
R7236:Simc1 UTSW 13 54524796 missense probably benign 0.03
R7297:Simc1 UTSW 13 54525235 intron probably benign
R7359:Simc1 UTSW 13 54503918 missense unknown
R7362:Simc1 UTSW 13 54539704 missense probably damaging 1.00
R7490:Simc1 UTSW 13 54524349 missense possibly damaging 0.84
R7792:Simc1 UTSW 13 54547330 missense probably damaging 1.00
R7855:Simc1 UTSW 13 54524832 missense probably benign 0.03
R7869:Simc1 UTSW 13 54503900 missense unknown
R8293:Simc1 UTSW 13 54526546 missense probably damaging 0.98
R8330:Simc1 UTSW 13 54525364 intron probably benign
X0023:Simc1 UTSW 13 54541531 missense probably damaging 0.98
Z1177:Simc1 UTSW 13 54524445 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCACTGCAAGATGTGCCACC -3'
(R):5'- ACTGTGTCACACCTCCTGATGACTG -3'

Sequencing Primer
(F):5'- AAGATGTGCCACCATTGCTG -3'
(R):5'- GACTGCATTACACTTCTTAGTGACTG -3'
Posted On2013-07-30