Incidental Mutation 'R7930:Senp5'
ID611835
Institutional Source Beutler Lab
Gene Symbol Senp5
Ensembl Gene ENSMUSG00000022772
Gene NameSUMO/sentrin specific peptidase 5
Synonyms6230429P13Rik, A730063F07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7930 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31959672-32003287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31990173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 88 (V88I)
Ref Sequence ENSEMBL: ENSMUSP00000023457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023457] [ENSMUST00000129900] [ENSMUST00000155515] [ENSMUST00000231360]
Predicted Effect probably benign
Transcript: ENSMUST00000023457
AA Change: V88I

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023457
Gene: ENSMUSG00000022772
AA Change: V88I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Pfam:Peptidase_C48 575 747 3.9e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129900
AA Change: V61I

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115257
Gene: ENSMUSG00000022772
AA Change: V61I

DomainStartEndE-ValueType
low complexity region 414 425 N/A INTRINSIC
Pfam:Peptidase_C48 548 603 5.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155515
SMART Domains Protein: ENSMUSP00000117481
Gene: ENSMUSG00000022772

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Peptidase_C48 156 208 2.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231360
AA Change: V88I

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Senp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Senp5 APN 16 31989173 missense probably damaging 1.00
IGL00990:Senp5 APN 16 31990274 missense probably benign 0.00
IGL01707:Senp5 APN 16 31989770 missense probably damaging 0.99
IGL01923:Senp5 APN 16 31965816 missense probably damaging 1.00
IGL01997:Senp5 APN 16 31963470 missense probably damaging 0.97
IGL02273:Senp5 APN 16 31989872 missense probably benign 0.14
IGL02560:Senp5 APN 16 31989392 missense probably benign
IGL02651:Senp5 APN 16 31990079 missense probably benign 0.04
IGL02830:Senp5 APN 16 31983485 splice site probably benign
R0578:Senp5 UTSW 16 31989345 missense possibly damaging 0.75
R1879:Senp5 UTSW 16 31983824 missense probably damaging 1.00
R2153:Senp5 UTSW 16 31968874 missense probably damaging 1.00
R4903:Senp5 UTSW 16 31983299 missense probably damaging 1.00
R5092:Senp5 UTSW 16 31989142 missense probably benign 0.00
R5590:Senp5 UTSW 16 31989513 missense probably damaging 0.99
R6346:Senp5 UTSW 16 31983847 missense probably damaging 1.00
R6362:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R6762:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R7002:Senp5 UTSW 16 31983775 missense probably damaging 1.00
R7027:Senp5 UTSW 16 31989295 missense probably benign
R7436:Senp5 UTSW 16 31976029 missense unknown
R7721:Senp5 UTSW 16 31990434 start codon destroyed unknown
R7847:Senp5 UTSW 16 31990173 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTTCGTGACCATTGGCTCTAC -3'
(R):5'- TTCTGAGAAATGGAATGCTGGG -3'

Sequencing Primer
(F):5'- GGCTCTACCTAAAACAGTGTTTGCTG -3'
(R):5'- AAGCTTTAAGAAGTTCTACTTTCCCC -3'
Posted On2019-12-27