Mutagenetix > Incidental Mutations

Incidental Mutation 'R0686:Kctd9'

61185

Institutional Source

Beutler Lab

Gene Symbol

Kctd9

Ensembl Gene

ENSMUSG00000034327

Gene Name

potassium channel tetramerisation domain containing 9

Synonyms

MMRRC Submission

038871-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0686 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

67715937-67742310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67728736 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 101 (T101A)

Ref Sequence

ENSEMBL: ENSMUSP00000115002 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000125212] [ENSMUST00000145542] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700]

Predicted Effect

unknown
Transcript: ENSMUST00000078053
AA Change: T101A

SMART Domains

Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327
AA Change: T101A

Domain	Start	End	E-Value	Type
Pfam:DUF3354	1	65	3.5e-22	PFAM
BTB	89	192	1.76e-16	SMART
Pfam:Pentapeptide	253	292	1e-14	PFAM
Pfam:Pentapeptide_4	258	334	2.7e-15	PFAM
Pfam:Pentapeptide	288	327	6.8e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125212

Predicted Effect

probably benign
Transcript: ENSMUST00000145542

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150768
AA Change: T101A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327
AA Change: T101A

Domain	Start	End	E-Value	Type
Pfam:KHA	2	64	1.4e-21	PFAM
BTB	89	192	1.76e-16	SMART
Pfam:Pentapeptide	219	255	9.3e-8	PFAM
Pfam:Pentapeptide	248	280	9.3e-11	PFAM
Pfam:Pentapeptide	258	297	3e-10	PFAM
Pfam:Pentapeptide	303	342	3.2e-13	PFAM
Pfam:Pentapeptide_4	308	384	3.3e-13	PFAM
Pfam:Pentapeptide	338	377	2.1e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152243

SMART Domains

Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327

Domain	Start	End	E-Value	Type
Pfam:BTB_2	1	70	1.3e-13	PFAM
Pfam:BTB	1	78	6.2e-7	PFAM
Pfam:Pentapeptide	105	137	4.3e-8	PFAM
Pfam:Pentapeptide	134	166	5.5e-11	PFAM
Pfam:Pentapeptide	144	183	1.5e-10	PFAM
Pfam:Pentapeptide_4	165	239	5.3e-9	PFAM
Pfam:Pentapeptide	189	228	1.7e-13	PFAM
Pfam:Pentapeptide	209	237	9.3e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000156700
AA Change: T101A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327
AA Change: T101A

Domain	Start	End	E-Value	Type
Pfam:DUF3354	1	65	2.5e-23	PFAM
SCOP:d3kvt__	89	107	9e-4	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	G	A	6: 40,928,518	S68F	probably damaging	Het
1700123K08Rik	C	T	5: 138,564,537	E42K	possibly damaging	Het
Arhgef12	A	C	9: 42,993,028	L718R	probably benign	Het
Bsx	T	G	9: 40,876,437	S136A	probably damaging	Het
Ccne2	T	A	4: 11,197,220	M174K	possibly damaging	Het
Ces1a	A	G	8: 93,022,449	Y445H	probably damaging	Het
Ckb	A	G	12: 111,670,193	V249A	probably benign	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Cyp2r1	T	G	7: 114,552,011	M358L	possibly damaging	Het
Dnah10	T	C	5: 124,747,718	I646T	possibly damaging	Het
Eps8l1	T	A	7: 4,477,450	D563E	probably benign	Het
Fam102b	G	A	3: 108,992,685	R116C	probably damaging	Het
Fam160a2	G	T	7: 105,388,309	L356I	probably damaging	Het
Fpr-rs4	A	C	17: 18,022,351	I207L	probably benign	Het
Fus	G	A	7: 127,972,763		probably benign	Het
Gm340	T	A	19: 41,582,372	S1R	possibly damaging	Het
Ireb2	A	T	9: 54,904,176	I755L	probably benign	Het
Ltbr	T	C	6: 125,308,061	D292G	possibly damaging	Het
Med1	G	A	11: 98,158,404	T507I	probably damaging	Het
Msh3	G	A	13: 92,351,431	P93S	possibly damaging	Het
Olfr705	A	T	7: 106,714,378	M101K	probably damaging	Het
Olfr970	A	C	9: 39,819,668	T10P	probably damaging	Het
Paqr5	T	G	9: 61,972,794	T59P	probably benign	Het
Pih1d1	T	A	7: 45,156,329	L74*	probably null	Het
Prim2	T	C	1: 33,514,189	T264A	probably benign	Het
Rasef	A	G	4: 73,734,534	S577P	probably damaging	Het
Simc1	T	A	13: 54,525,190	S450R	probably benign	Het
Tdrd1	A	T	19: 56,856,051	N796I	probably damaging	Het
Vmn1r214	T	A	13: 23,034,792	I152N	probably damaging	Het

Other mutations in Kctd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02706:Kctd9	APN	14	67724681	critical splice donor site	probably null
IGL03034:Kctd9	APN	14	67734279	missense	probably benign	0.36
domain	UTSW	14	67724673	nonsense	probably null
model	UTSW	14	67729692	missense	possibly damaging	0.95
motif	UTSW	14	67729356	missense	probably damaging	1.00
Prototype	UTSW	14	67740387	missense	probably damaging	1.00
R1069:Kctd9	UTSW	14	67729420	splice site	probably benign
R3737:Kctd9	UTSW	14	67734288	missense	possibly damaging	0.92
R3738:Kctd9	UTSW	14	67734288	missense	possibly damaging	0.92
R4785:Kctd9	UTSW	14	67734164	missense	probably damaging	1.00
R4939:Kctd9	UTSW	14	67729686	missense	probably damaging	1.00
R4989:Kctd9	UTSW	14	67729356	missense	probably damaging	1.00
R5133:Kctd9	UTSW	14	67729356	missense	probably damaging	1.00
R5138:Kctd9	UTSW	14	67728748	critical splice donor site	probably null
R5232:Kctd9	UTSW	14	67724661	missense	probably damaging	1.00
R5454:Kctd9	UTSW	14	67740387	missense	probably damaging	1.00
R6642:Kctd9	UTSW	14	67724673	nonsense	probably null
R7128:Kctd9	UTSW	14	67738523	missense	probably benign	0.02
R7863:Kctd9	UTSW	14	67729717	missense	possibly damaging	0.84
R8068:Kctd9	UTSW	14	67724662	missense	unknown
R8166:Kctd9	UTSW	14	67729692	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CCTGATCACCCAAAGGACTTCCTTC -3'
(R):5'- GTGCAGTAAGTTGCCAAAATCCCTTC -3'

Sequencing Primer
(F):5'- AGACTAGCAGCTTTGTGGACTC -3'
(R):5'- ATGTGCAGTTGGTTTACCACTAC -3'

Posted On

2013-07-30