Incidental Mutation 'R0686:Kctd9'
ID61185
Institutional Source Beutler Lab
Gene Symbol Kctd9
Ensembl Gene ENSMUSG00000034327
Gene Namepotassium channel tetramerisation domain containing 9
Synonyms
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0686 (G1)
Quality Score93
Status Not validated
Chromosome14
Chromosomal Location67715937-67742310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67728736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 101 (T101A)
Ref Sequence ENSEMBL: ENSMUSP00000115002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000125212] [ENSMUST00000145542] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700]
Predicted Effect unknown
Transcript: ENSMUST00000078053
AA Change: T101A
SMART Domains Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327
AA Change: T101A

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 3.5e-22 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 253 292 1e-14 PFAM
Pfam:Pentapeptide_4 258 334 2.7e-15 PFAM
Pfam:Pentapeptide 288 327 6.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125212
Predicted Effect probably benign
Transcript: ENSMUST00000145542
Predicted Effect possibly damaging
Transcript: ENSMUST00000150768
AA Change: T101A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327
AA Change: T101A

DomainStartEndE-ValueType
Pfam:KHA 2 64 1.4e-21 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 219 255 9.3e-8 PFAM
Pfam:Pentapeptide 248 280 9.3e-11 PFAM
Pfam:Pentapeptide 258 297 3e-10 PFAM
Pfam:Pentapeptide 303 342 3.2e-13 PFAM
Pfam:Pentapeptide_4 308 384 3.3e-13 PFAM
Pfam:Pentapeptide 338 377 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152243
SMART Domains Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:BTB_2 1 70 1.3e-13 PFAM
Pfam:BTB 1 78 6.2e-7 PFAM
Pfam:Pentapeptide 105 137 4.3e-8 PFAM
Pfam:Pentapeptide 134 166 5.5e-11 PFAM
Pfam:Pentapeptide 144 183 1.5e-10 PFAM
Pfam:Pentapeptide_4 165 239 5.3e-9 PFAM
Pfam:Pentapeptide 189 228 1.7e-13 PFAM
Pfam:Pentapeptide 209 237 9.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156700
AA Change: T101A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327
AA Change: T101A

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 2.5e-23 PFAM
SCOP:d3kvt__ 89 107 9e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fpr-rs4 A C 17: 18,022,351 I207L probably benign Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Kctd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Kctd9 APN 14 67724681 critical splice donor site probably null
IGL03034:Kctd9 APN 14 67734279 missense probably benign 0.36
domain UTSW 14 67724673 nonsense probably null
motif UTSW 14 67729356 missense probably damaging 1.00
Prototype UTSW 14 67740387 missense probably damaging 1.00
R1069:Kctd9 UTSW 14 67729420 splice site probably benign
R3737:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R3738:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R4785:Kctd9 UTSW 14 67734164 missense probably damaging 1.00
R4939:Kctd9 UTSW 14 67729686 missense probably damaging 1.00
R4989:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5133:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5138:Kctd9 UTSW 14 67728748 critical splice donor site probably null
R5232:Kctd9 UTSW 14 67724661 missense probably damaging 1.00
R5454:Kctd9 UTSW 14 67740387 missense probably damaging 1.00
R6642:Kctd9 UTSW 14 67724673 nonsense probably null
R7128:Kctd9 UTSW 14 67738523 missense probably benign 0.02
R7863:Kctd9 UTSW 14 67729717 missense possibly damaging 0.84
R7946:Kctd9 UTSW 14 67729717 missense possibly damaging 0.84
R7960:Kctd9 UTSW 14 67738173 intron probably null
R8068:Kctd9 UTSW 14 67724662 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGATCACCCAAAGGACTTCCTTC -3'
(R):5'- GTGCAGTAAGTTGCCAAAATCCCTTC -3'

Sequencing Primer
(F):5'- AGACTAGCAGCTTTGTGGACTC -3'
(R):5'- ATGTGCAGTTGGTTTACCACTAC -3'
Posted On2013-07-30