Incidental Mutation 'R0686:Fpr-rs4'
ID61186
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission 038871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0686 (G1)
Quality Score119
Status Not validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 18022351 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 207 (I207L)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably benign
Transcript: ENSMUST00000095651
AA Change: I207L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: I207L

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,928,518 S68F probably damaging Het
1700123K08Rik C T 5: 138,564,537 E42K possibly damaging Het
Arhgef12 A C 9: 42,993,028 L718R probably benign Het
Bsx T G 9: 40,876,437 S136A probably damaging Het
Ccne2 T A 4: 11,197,220 M174K possibly damaging Het
Ces1a A G 8: 93,022,449 Y445H probably damaging Het
Ckb A G 12: 111,670,193 V249A probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Cyp2r1 T G 7: 114,552,011 M358L possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Eps8l1 T A 7: 4,477,450 D563E probably benign Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fam160a2 G T 7: 105,388,309 L356I probably damaging Het
Fus G A 7: 127,972,763 probably benign Het
Gm340 T A 19: 41,582,372 S1R possibly damaging Het
Ireb2 A T 9: 54,904,176 I755L probably benign Het
Kctd9 A G 14: 67,728,736 T101A probably damaging Het
Ltbr T C 6: 125,308,061 D292G possibly damaging Het
Med1 G A 11: 98,158,404 T507I probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Olfr705 A T 7: 106,714,378 M101K probably damaging Het
Olfr970 A C 9: 39,819,668 T10P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Pih1d1 T A 7: 45,156,329 L74* probably null Het
Prim2 T C 1: 33,514,189 T264A probably benign Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Simc1 T A 13: 54,525,190 S450R probably benign Het
Tdrd1 A T 19: 56,856,051 N796I probably damaging Het
Vmn1r214 T A 13: 23,034,792 I152N probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R8703:Fpr-rs4 UTSW 17 18022070 missense probably damaging 0.99
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCCCAGTATGGTCTCAGAATCACC -3'
(R):5'- ACAAGTTGCTGTCTGTGTCAGTGC -3'

Sequencing Primer
(F):5'- ATCACCGAACTGTGAGTCTG -3'
(R):5'- CAGTGCTCAGGACTGAATTTTC -3'
Posted On2013-07-30