Incidental Mutation 'R0687:Ccdc150'
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
MMRRC Submission 038872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0687 (G1)
Quality Score201
Status Not validated
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to T at 54285631 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably null
Transcript: ENSMUST00000027128
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983

coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T G 7: 34,245,418 Q679P possibly damaging Het
Anxa10 T A 8: 62,092,572 D42V possibly damaging Het
B3gnt9 T A 8: 105,254,783 probably benign Het
Fstl5 A G 3: 76,707,812 I727V possibly damaging Het
Nae1 C A 8: 104,513,244 R484L probably damaging Het
Nudt19 T A 7: 35,551,472 T281S probably benign Het
Osgin1 T A 8: 119,445,832 V455E probably damaging Het
Pcnx3 A T 19: 5,684,333 D655E probably damaging Het
Plch1 C T 3: 63,716,029 V617M probably damaging Het
Polk A T 13: 96,484,017 N579K probably damaging Het
Scube2 C A 7: 109,829,128 V513F possibly damaging Het
Skiv2l2 T C 13: 112,914,361 T227A probably damaging Het
Spen T C 4: 141,488,028 M498V unknown Het
Tm7sf3 T A 6: 146,621,890 N163I possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp24 A T 4: 106,420,504 K2277I probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctccactatttttcattcccacc -3'
Posted On2013-07-30