Incidental Mutation 'R0687:Ccdc150'
ID 61189
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
MMRRC Submission 038872-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0687 (G1)
Quality Score 201
Status Not validated
Chromosome 1
Chromosomal Location 54289842-54407886 bp(+) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to T at 54324790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably null
Transcript: ENSMUST00000027128
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa10 T A 8: 62,545,606 (GRCm39) D42V possibly damaging Het
B3gnt9 T A 8: 105,981,415 (GRCm39) probably benign Het
Fstl5 A G 3: 76,615,119 (GRCm39) I727V possibly damaging Het
Garre1 T G 7: 33,944,843 (GRCm39) Q679P possibly damaging Het
Mtrex T C 13: 113,050,895 (GRCm39) T227A probably damaging Het
Nae1 C A 8: 105,239,876 (GRCm39) R484L probably damaging Het
Nudt19 T A 7: 35,250,897 (GRCm39) T281S probably benign Het
Osgin1 T A 8: 120,172,571 (GRCm39) V455E probably damaging Het
Pcnx3 A T 19: 5,734,361 (GRCm39) D655E probably damaging Het
Plch1 C T 3: 63,623,450 (GRCm39) V617M probably damaging Het
Polk A T 13: 96,620,525 (GRCm39) N579K probably damaging Het
Scube2 C A 7: 109,428,335 (GRCm39) V513F possibly damaging Het
Spen T C 4: 141,215,339 (GRCm39) M498V unknown Het
Tm7sf3 T A 6: 146,523,388 (GRCm39) N163I possibly damaging Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Usp24 A T 4: 106,277,701 (GRCm39) K2277I probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54,311,709 (GRCm39) splice site probably benign
IGL00819:Ccdc150 APN 1 54,302,732 (GRCm39) missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54,339,647 (GRCm39) splice site probably null
IGL02352:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54,302,704 (GRCm39) nonsense probably null
IGL02673:Ccdc150 APN 1 54,368,149 (GRCm39) missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54,317,874 (GRCm39) missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54,339,482 (GRCm39) missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54,329,861 (GRCm39) missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0217:Ccdc150 UTSW 1 54,339,589 (GRCm39) missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54,368,670 (GRCm39) missense probably benign
R0790:Ccdc150 UTSW 1 54,316,935 (GRCm39) splice site probably benign
R1146:Ccdc150 UTSW 1 54,404,130 (GRCm39) splice site probably benign
R1288:Ccdc150 UTSW 1 54,403,617 (GRCm39) missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54,393,795 (GRCm39) missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54,407,069 (GRCm39) intron probably benign
R1957:Ccdc150 UTSW 1 54,303,068 (GRCm39) missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54,311,706 (GRCm39) critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54,404,084 (GRCm39) missense probably null 0.11
R3054:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54,407,469 (GRCm39) missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54,317,970 (GRCm39) missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54,392,213 (GRCm39) missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54,394,913 (GRCm39) missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54,317,874 (GRCm39) missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54,404,027 (GRCm39) intron probably benign
R5028:Ccdc150 UTSW 1 54,302,636 (GRCm39) missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54,393,806 (GRCm39) missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54,302,779 (GRCm39) missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54,339,526 (GRCm39) missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54,316,873 (GRCm39) missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54,302,758 (GRCm39) missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54,407,176 (GRCm39) missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54,303,116 (GRCm39) splice site probably null
R6988:Ccdc150 UTSW 1 54,394,868 (GRCm39) nonsense probably null
R7248:Ccdc150 UTSW 1 54,344,057 (GRCm39) missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54,302,496 (GRCm39) splice site probably null
R7322:Ccdc150 UTSW 1 54,299,125 (GRCm39) missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54,339,541 (GRCm39) nonsense probably null
R7647:Ccdc150 UTSW 1 54,395,863 (GRCm39) missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54,407,551 (GRCm39) missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54,311,656 (GRCm39) missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54,368,646 (GRCm39) missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54,407,132 (GRCm39) missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54,302,668 (GRCm39) missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54,311,641 (GRCm39) missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54,311,644 (GRCm39) missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54,299,197 (GRCm39) missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54,316,910 (GRCm39) missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54,324,760 (GRCm39) missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54,317,990 (GRCm39) missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54,320,930 (GRCm39) missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54,407,544 (GRCm39) nonsense probably null
R9747:Ccdc150 UTSW 1 54,299,107 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGAGCCTGGGGACTTTAGGAAG -3'
(R):5'- TGTGACTCATTTAGCCTTGTGTACCAC -3'

Sequencing Primer
(F):5'- ctccactatttttcattcccacc -3'
(R):5'- AGCCTTGTGTACCACAGAGTC -3'
Posted On 2013-07-30