Mutagenetix > Incidental Mutation

Incidental Mutation 'R0687:Usp24'

61192

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

038872-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0687 (G1)

Quality Score

109

Status

Not validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 106420504 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Isoleucine at position 2277 (K2277I)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably damaging
Transcript: ENSMUST00000094933
AA Change: K2276I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: K2276I

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165709
AA Change: K2277I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: K2277I

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	G	7: 34,245,418	Q679P	possibly damaging	Het
Anxa10	T	A	8: 62,092,572	D42V	possibly damaging	Het
B3gnt9	T	A	8: 105,254,783		probably benign	Het
Ccdc150	A	T	1: 54,285,631		probably null	Het
Fstl5	A	G	3: 76,707,812	I727V	possibly damaging	Het
Nae1	C	A	8: 104,513,244	R484L	probably damaging	Het
Nudt19	T	A	7: 35,551,472	T281S	probably benign	Het
Osgin1	T	A	8: 119,445,832	V455E	probably damaging	Het
Pcnx3	A	T	19: 5,684,333	D655E	probably damaging	Het
Plch1	C	T	3: 63,716,029	V617M	probably damaging	Het
Polk	A	T	13: 96,484,017	N579K	probably damaging	Het
Scube2	C	A	7: 109,829,128	V513F	possibly damaging	Het
Skiv2l2	T	C	13: 112,914,361	T227A	probably damaging	Het
Spen	T	C	4: 141,488,028	M498V	unknown	Het
Tm7sf3	T	A	6: 146,621,890	N163I	possibly damaging	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ACGCTGGTTTACTTCACATTAGCCC -3'
(R):5'- AAGACTTCTGAGCCTTCCACTGCC -3'

Sequencing Primer
(F):5'- ACATTAGCCCTGTGGCAGTG -3'
(R):5'- ACTGCTGCCACTACTTGTATCAG -3'

Posted On

2013-07-30