Incidental Mutation 'R7932:Gpr89'
ID611920
Institutional Source Beutler Lab
Gene Symbol Gpr89
Ensembl Gene ENSMUSG00000028096
Gene NameG protein-coupled receptor 89
Synonyms4933412D19Rik, SH120
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R7932 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96868281-96905346 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96871490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 422 (Y422*)
Ref Sequence ENSEMBL: ENSMUSP00000029738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029738] [ENSMUST00000058865] [ENSMUST00000107069] [ENSMUST00000107070] [ENSMUST00000153256]
Predicted Effect probably null
Transcript: ENSMUST00000029738
AA Change: Y422*
SMART Domains Protein: ENSMUSP00000029738
Gene: ENSMUSG00000028096
AA Change: Y422*

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
Pfam:GPHR_N 140 207 1.1e-31 PFAM
Pfam:ABA_GPCR 276 446 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058865
SMART Domains Protein: ENSMUSP00000058936
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107069
SMART Domains Protein: ENSMUSP00000102684
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107070
SMART Domains Protein: ENSMUSP00000102685
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153256
SMART Domains Protein: ENSMUSP00000118846
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,026,328 I325N Het
Agap1 T C 1: 89,630,419 V143A probably damaging Het
Agmo A G 12: 37,242,045 R2G probably benign Het
Alms1 A T 6: 85,621,497 I1102L possibly damaging Het
Ankrd13a T C 5: 114,791,282 I140T possibly damaging Het
Arhgef10l T A 4: 140,583,934 probably null Het
Atxn2l A T 7: 126,493,173 H967Q possibly damaging Het
B3galnt2 A T 13: 13,994,492 N370I probably benign Het
BC053393 T A 11: 46,577,231 I44K not run Het
Cacna1e C T 1: 154,633,718 D264N probably damaging Het
Ccdc112 A T 18: 46,296,323 Y103N probably benign Het
Ccdc68 A C 18: 69,947,175 E197A probably damaging Het
Cntn3 T C 6: 102,265,431 M418V probably benign Het
Cpne4 T A 9: 104,686,519 C32S probably damaging Het
Csf2rb2 A T 15: 78,284,421 S845T probably benign Het
Ctnnd2 T G 15: 31,027,587 V1219G probably damaging Het
Cyp4f14 G A 17: 32,909,351 A230V probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 T A 18: 49,961,147 C2897S probably benign Het
Elavl2 T A 4: 91,372,043 probably benign Het
Fam135a T C 1: 24,044,250 E298G probably damaging Het
Fbn1 A T 2: 125,309,485 I2534N probably damaging Het
Fibin A G 2: 110,362,480 S106P probably damaging Het
Fndc3a C T 14: 72,564,660 V568M probably benign Het
Frem2 A G 3: 53,572,374 F1966S probably damaging Het
Gata4 T G 14: 63,204,725 E216A possibly damaging Het
Gmps T A 3: 64,015,563 V649E probably benign Het
Golga4 A T 9: 118,559,311 N1834Y possibly damaging Het
Gzmc A T 14: 56,232,372 F157Y probably benign Het
Hdhd2 A G 18: 76,965,266 D204G probably damaging Het
Hspa4 T G 11: 53,280,703 T225P possibly damaging Het
Ikbkap A T 4: 56,758,968 S1191T possibly damaging Het
Klhl30 T A 1: 91,359,337 D448E probably benign Het
Kptn A G 7: 16,120,041 Y28C probably damaging Het
Krt10 A T 11: 99,387,606 N242K probably damaging Het
Krt6b A T 15: 101,678,574 N254K probably damaging Het
Lama5 G T 2: 180,201,812 D447E probably damaging Het
Lgr6 T C 1: 134,987,681 Y720C probably damaging Het
Macf1 G C 4: 123,407,599 P1037A probably benign Het
Map3k19 C T 1: 127,823,646 G656D probably benign Het
Mical2 T A 7: 112,323,461 probably null Het
Mroh7 A C 4: 106,721,090 N130K probably benign Het
Muc16 T C 9: 18,640,505 T4831A probably benign Het
Nbea A T 3: 55,990,875 probably null Het
Nfkb1 A T 3: 135,585,412 L533H Het
Olfr1033 G A 2: 86,041,605 V97I probably benign Het
Olfr1265 A G 2: 90,037,282 Y121C probably damaging Het
Olfr151 A G 9: 37,730,707 I92T probably damaging Het
Olfr639 C A 7: 104,012,303 R133L possibly damaging Het
Olfr971 A G 9: 39,840,322 D296G possibly damaging Het
Otub1 T C 19: 7,200,060 D74G probably damaging Het
Oxct2b A G 4: 123,116,887 E200G probably damaging Het
Pcdh1 T C 18: 38,189,609 D1057G probably benign Het
Pkd1 T A 17: 24,586,200 V3242E probably damaging Het
Pla2g4e T A 2: 120,185,322 D247V probably benign Het
Pole T A 5: 110,332,548 M1995K probably benign Het
Ppargc1a T C 5: 51,548,513 E76G probably benign Het
Pten G T 19: 32,799,996 R130L probably damaging Het
Ptprj A T 2: 90,444,460 V1186D probably damaging Het
Rab4a T A 8: 123,806,137 M1K probably null Het
Rapgef3 C A 15: 97,758,390 probably null Het
Rarb C A 14: 16,548,473 V83F probably damaging Het
Rgs22 A T 15: 36,099,712 F410I probably damaging Het
Rhpn2 A C 7: 35,381,487 E459A probably benign Het
Rims4 A T 2: 163,864,054 L220Q probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Sbf2 T C 7: 110,372,510 H839R probably damaging Het
Setbp1 T C 18: 78,856,853 R1200G probably benign Het
Slc12a8 C A 16: 33,624,560 P275T probably damaging Het
Slc23a1 G T 18: 35,624,501 T239N probably benign Het
Slc37a3 T A 6: 39,364,583 T40S possibly damaging Het
Speer4c T C 5: 15,710,927 probably null Het
Tet1 A T 10: 62,819,473 H1556Q possibly damaging Het
Tfcp2l1 T A 1: 118,675,595 D454E probably damaging Het
Tmem123 A T 9: 7,790,889 M64L probably benign Het
Tmem62 A T 2: 120,984,372 H172L probably benign Het
Trim15 T G 17: 36,866,872 Y77S probably benign Het
Trim37 T A 11: 87,201,444 V693E possibly damaging Het
Trim65 A G 11: 116,126,256 L460S probably damaging Het
Ttc39a T C 4: 109,422,490 V109A probably benign Het
Ttc7 A G 17: 87,292,946 M163V probably null Het
Vps13b T C 15: 35,423,232 S233P probably damaging Het
Vwf T C 6: 125,656,803 L2084P Het
Wasl A G 6: 24,633,923 V114A possibly damaging Het
Wdr5 A G 2: 27,519,451 S62G probably damaging Het
Wfdc11 G T 2: 164,665,525 S4* probably null Het
Wfikkn2 C A 11: 94,238,984 M110I probably benign Het
Wiz T G 17: 32,357,786 E588A probably benign Het
Xylt1 A G 7: 117,656,668 H821R probably benign Het
Zbtb7c A T 18: 76,145,701 H410L probably benign Het
Zc3h18 T A 8: 122,383,971 D186E probably damaging Het
Zfp687 G T 3: 95,010,362 L700I possibly damaging Het
Zmym2 T A 14: 56,946,563 M994K probably benign Het
Other mutations in Gpr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gpr89 APN 3 96898523 missense probably damaging 1.00
IGL00757:Gpr89 APN 3 96871534 missense probably benign 0.00
IGL01114:Gpr89 APN 3 96893549 missense probably damaging 0.98
IGL02417:Gpr89 APN 3 96897425 nonsense probably null
explorer UTSW 3 96880069 splice site probably null
R0207:Gpr89 UTSW 3 96871480 missense probably damaging 0.99
R0650:Gpr89 UTSW 3 96897324 splice site probably benign
R0704:Gpr89 UTSW 3 96880168 critical splice acceptor site probably null
R1496:Gpr89 UTSW 3 96905210 missense probably benign 0.00
R1869:Gpr89 UTSW 3 96875659 missense probably benign 0.16
R1913:Gpr89 UTSW 3 96875633 missense possibly damaging 0.91
R2264:Gpr89 UTSW 3 96872515 missense probably damaging 0.99
R2276:Gpr89 UTSW 3 96897427 missense probably damaging 1.00
R3822:Gpr89 UTSW 3 96892944 missense probably benign 0.03
R3922:Gpr89 UTSW 3 96890899 missense probably damaging 1.00
R4984:Gpr89 UTSW 3 96905196 missense probably benign 0.02
R5761:Gpr89 UTSW 3 96892880 missense probably damaging 1.00
R6185:Gpr89 UTSW 3 96890833 missense probably damaging 0.99
R7063:Gpr89 UTSW 3 96875698 missense probably damaging 1.00
R7164:Gpr89 UTSW 3 96871398 missense probably benign 0.04
R7172:Gpr89 UTSW 3 96880069 splice site probably null
R7215:Gpr89 UTSW 3 96880088 missense probably damaging 1.00
R7536:Gpr89 UTSW 3 96890893 missense probably damaging 0.96
R7708:Gpr89 UTSW 3 96880625 missense possibly damaging 0.81
R7849:Gpr89 UTSW 3 96871490 nonsense probably null
RF019:Gpr89 UTSW 3 96905193 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTATCTCAGGAGGAAGTAGGC -3'
(R):5'- AAGTTTGCACTGGCTTGCC -3'

Sequencing Primer
(F):5'- AGCTCTGCCTGTGTAAAGAGC -3'
(R):5'- TGGCTTGCCCCTCAAAACAG -3'
Posted On2019-12-27